TABLE 1

Details of PCR assays used to identify respiratory viruses

Reaction MixVirusTargetPrimer, Probe Sequences (5′–3′), and FluorophoresSource
1Influenza AMatrix proteinCTTCTAACCGAGGTCGAAACGTA GGTGACAGGATTGGTCTTGTCTTTA fam-TCAGGCCCCCTCAAAGCCGAG-bhq1Whiley and Sloots20
Influenza BMatrix proteinGCATCTTTTGTTTTTTATCCATTCC CACAATTGCCTACCTGCTTTCA joe-GCTAGTTCTGCTTTGCCTTCTCCATCTTCT-bhq1This study
2Parainfluenza IHemagglutinin-neuraminidaseTTTAAACCCGGTAATTTCTCATACCT CCCCTTGTTCCTGCAGCTATT fam-TGACATCAACGACAACAGGAAATCATGTTCTG-bhq1This study
Parainfluenza IINucleocapsidAGAGTTCCAACATTCAATGAATCAGT CTCAAGAGAAATGTCATTCCCATCT joe-CCTCTGTATTGCTCATGCATAGCACGGA-bhq1This study
Parainfluenza IIINucleocapsidCGGTGACACAGTGGATCAGATT AGGTCATTTCTGCTAGTATTCATTGTTATT Cy5-TCAATCATGCGGTCTCAACAGAGCTTG-bhq2Whiley and Sloots21
3RSVPolymerase (L)AGTAGACCATGTGAATTCCCTGC GTCGATATCTTCATCACCATACTTTTCTGTTA fam-TCAATACCAGCTTATAGAAC-mgb-bhq1Whiley and Sloots22
AdenovirusHexon proteinGCCACGGTGGGGTTTCTAAACTT GCCCCAGTGGTCTTACATGCACAT joe-TGCACCAGACCCGGGCTCAGGTACTCCGA-bhq1Heim et al23
4hMPVNucleocapsidCATATAAGCATGCTATATTAAAAGAGTCTC CCTATTTCTGCAGCATATTTGTAATCAG fam-TGYAATGATGAGGGTGTCACTGCGGTTG-bhq1Maertzdorf et al24
  • bhq indicates black hole quencher; mgb, minor groove binder.