TABLE 1

Primer and Probe Characteristics for the Real-Time and Nested PCR Assays

OligonucleotideGC content, %Melting Temperature, °C5′ positiona3′ positionaSequencebGene AmplifiedAmplicon Size, bp
In-house F forward5064.168956914TCGGACCAGATATTGAGGAGFusion111
In-house F reverse4364.870056985GCAACATATTAAAGCGgGGAT
In-house F probe5368.169686984TTGGAGgGTTGATAGgG
Uhlmann N1 forward6059.613251344TCAGTAGAGCGGTTGGACCCNucleoprotein150
Uhlmann N1 reverse6060.314751456GGCCCGGTTTCTCTGTAGCT
Uhlmann F1 forward5056.555935612TGACTCGTTCCAGCCATCAAFusion150
Uhlmann F1 reverse4355.158435823TGGGTCATTGCATTAAGTGCA
Uhlmann H1 forward5557.274487467TTCATCGGGCAGCCATCTACHemagglutinin150
Uhlmann H1 reverse6559.575987579CTCTGAGGTGTCCTCAGGCC
Uhlmann GAPDH15653.9NANAGAAGGTGAAGGTCGGAGTGAPDH226
Uhlmann GAPDH24550.8NANAGAAGATGGTGATGGGATTTC
Kawashima PtF7 forward5461.647774798ACTCCACAACCGAACCGCACAAFusion (outer)834
Kawashima PtF14 reverse4854.656115591GATGGCTGGAACGAGTCATAA
Kawashima PtF11 forward5256.453045324GACATCAGTATCCCACAGCCTFusion (inner)181
Kawashima PtF13 reverse5662.455915461TGGCAGAGACGTTCACCTTGAGACC
Kawashima H3 forward4455.481068130CAGTCAGTAATGATCTCAGCAACTGHemagglutinin (outer)595
Kawashima H6 reverse4456.486778701CTTGAATCTCGGTATCCACTCCAAT
Kawashima H5 forward5259.183698392TCCCGACAACACGAACAGATGACHemagglutinin (inner)332
Kawashima H6 reverse4456.486778701CTTGAATCTCGGTATCCACTCCAAT
  • a Nucleotide positions for Edmonston, vaccine-strain virus (National Center for Biotechnology Information nucleotide sequence database accession No. AF266788).

  • b Lowercase letters represent superbases.