TABLE 1

Mitochondrial PCR Primers and Probes

Primer/ProbeNucleotide Sequence (5′ to 3′)Tm, °CLocation Within ND5
Human 5′ primerCAGCAGCCATTCAAGCAATGC57.9497–517
Human 3′ primerGGTGGAGACCTAATTGGGCTGATTAG58.8666–691
Human probeTATCGGCGATATCGGTTTCATCCTCG59.9528–553
Bovine 5′ primerCAGCAGCCCTACAAGCAATGT58.1497–517
Bovine 3′ primerGAGGCCAAATTGGGCGGATTAT58.0666–687
Bovine probeCATCGGCGACATTGGTTTCATTTTAG56.9528–552
  • ND5, NADH dehydrogenase subunit 5; Tm, melting temperature.