TABLE 1

Primer Pairs for Genetic Analysis of the NR3C1 Gene

LocusaForwardReverse
Exon 2GTTCGATACACTTTTGCCCTACAAATAAGGCAGCACAACT
AGAGAACCCCAAGAGTTCAGCAGTTCGACCAGGGAAGTTCAGAGT
Exon 3TAGGAGGCATCTTTTTGGGATGCCCAAACTTAACACCATC
Exon 4TTTTGACCTCTCGACCTCATAACCCATCCAGTTCTTCCTT
Exon 5AATGTTTTTAGTCCCACGCAAACATTGACCTCTGCCATTC
Exon 6CATTTTCTGTTAGGGGTGCCGAGTGAGGAAACAACTGCAA
Exon 7TAGGATGGACTGCTGTGAAATCTCTGTTTCTGCCATACCT
Exon 8ATCCTGCATTTTCTCTTGGCAAGCACTTCCGTACAAAACA
Exon 9AGTTTGTGGATGTTGGTGATAGTGCAAAAATAGGGCGTTAGG
AATTCCCCGAGATGTTAGCTGAGACAGATGGGAATGTGAAAATGGG
GTGGATGATGGTTGCAAAAGACGGCAACCTATGAGATTCTGCAC
GCATTCATACAGGCAGCGATGTGAATTCTGAAGGGAGCGTGG
GGTGCCTAAGAAAACTGCTTTACCCTTTGCAGTAATTGGC
Bcll SNPAGCAGAAGTACTAACAAAGAGCATCTGAATTGGGGATGAGGT
  • a All exons include their intron–exon junctions.