Placental Leptin: An Important New Growth Factor in Intrauterine and Neonatal Development?

Study Subjects

One hundred consecutive pregnant women and their newborns were enrolled in this study. Anthropometric measurements and blood sampling of mother and newborn were performed at the time of delivery. Table1 presents demographic and anthropometric data for mothers and newborns. This was the first pregnancy for 31 of the mothers, the second for 28, the third for 19, and the fourth or greater pregnancy for 20 mothers with information on two pregnancies not available. Mean maternal BMI (body mass index) before pregnancy was 26.17 [ ±7.55 (SD)]. Three percent of the newborns had gestational ages of 32 weeks or less. Twenty-seven deliveries were by caesarean section. Informed consent was obtained from the mothers for themselves and their newborns. This study was approved by the Institutional Review Boards of the Alfred I. duPont Institute and the two birthplace hospitals, Thomas Jefferson University Hospital and the Medical Center of Delaware.

Forty-three children in Tanner stages 1 and 2 were used as a comparison to the newborns. This control group included 25 males and 18 females (n = 43), 35 white, 7 black, 1 other, with an overall mean age (10.25 yr, ±1.67 SD), and mean BMI (17.67 ± 3.46 SD).

Procedures

Maternal height was measured to the nearest cm by stadiometer; weight was measured to the nearest .1 kg on a balance beam scale, and BMI was calculated by dividing the weight in kilograms by the height in meters squared. Triceps skinfold was measured at the mid-arm distance to the nearest millimeter using Lange calipers. Arm fat was calculated from the measured mid-arm circumference and triceps skinfold according to the formulas provided by Must and colleagues.¹³Prepregnancy weight was obtained by history.

Newborn lengths were obtained to the nearest mm and weights to the nearest .1 kg. Triceps skinfold measurements and mid-arm circumference were measured as described above. Arm fat was calculated as for mothers, because there is not yet an accepted standard for determining adiposity in newborns.

A venous blood sample was collected from the mother and a cord blood sample from the newborn at the time of delivery. Serum was frozen at −70°C until analysis. Radioimmunoassay (Linco Research, St. Charles, MO) for serum leptin was performed as previously described by Considine et al.⁶ Serum insulin was measured by radioimmunoassay (Linco Research, St. Charles, MO), and serum glucose was measured by the glucose oxidase method with a glucose analyzer 29 (Beckman, Brea, CA).

Cell Lines and Tissues

Biopsies of both subcutaneous and abdominal fat were obtained from children undergoing orthopedic surgery. A biopsy of abdominal fat was obtained from an obese pregnant woman. Human placental cell lines, JAR¹⁴ and JEG-3,¹⁵ were obtained from the American Type Culture Collection (Rockville, MD). JAR cells were grown in RPMI medium 1640 with 10% (vol/vol) fetal calf serum and penicillin-streptomycin, and JEG-3 cells were cultured in α-MEM medium with 15% (vol/vol) fetal calf serum and penicillin-streptomycin.

RNA Isolation and RT/PCR Analysis

After cells reached confluence, total RNA was extracted using the RNeasy kit (Qiagen, Chatsworth, CA) according to the manufacturer's instructions. Placental tissues were frozen in liquid nitrogen, pulverized with a mortar and pestle, and total RNA was extracted as described above. Total RNA from two additional human placentas was obtained from Clontech (Palo Alto, CA). RNA concentration and purity were determined by absorbency at 260 and 280 nm. One microgram of total RNA was reverse-transcribed using avian myeloblastosis virus and oligo (dT) primer (Promega, Madison, WI), according to the manufacturer's instructions. The reverse transcription reaction was performed at 42°C for 15 min. Subsequent amplification of the cDNA sequence was performed with 10 μL of the reverse transcription reaction in 1X Taq buffer, 5% dimethylsulfoxide, 25 pmol each of leptin exon 2 forward (5′CATTGGGGAACCCTGTGCGGATTC3′) and exon 3 reverse (5′TGGCAGCTCTTAGAGAAGGCCAGC3′) PCR primers, and 1.25 U Taqpolymerase in a 50-μL reaction volume. For assessment of the relative levels of leptin to β-actin, a multiplex RT/PCR approach was used as described by Dukas et al.¹⁶ The PCR reaction was done as described above except that the β-actin primers (forward: 5′TGTATGCCTCTGGTCGTACCAC3′; reverse: 5′ACAGAGTACTTGCGCTCAGGAG3′) were added at 6.25 pmol/μL. The temperature profile for the PCR reactions consisted of a 2-min melting step at 95°C, then 30 cycles of 30 s at 94°C, 30 s at 55°C, and 90 sec at 65°C, followed by a final extension step of 6 min at 65°C. Independent experiments established that 30 cycles were within the linear range of the multiplex PCR assay. RT/PCR products were separated by size on a 4% agarose gel and stained with ethidium bromide. Images were transferred to an Apple MacIntosh Quadra 800 via an Eagle Eye still video imaging system, and the relative band intensities analyzed with National Center for Supercomputing Applications Gelreader Version 2.07 software.

Statistical Analysis

Because of variation in the distribution of serum leptin concentrations and estimates of percentage body fat, the relations between continuous variables were evaluated by Spearman rank correlations. A log (Ln) transformation of serum leptin levels was performed to normalize the distribution of values to meet the assumptions for subsequent analyses. All analyses were performed using the general factorial analyses of covariance model, controlling for the effects of both BMI and upper arm fat. Arm fat and BMI were selected as covariates because of their high correlations with serum leptin concentrations.^6,7 Post hoc (Tukey) analyses were performed to determine differences between males and females, and between newborns and Tanner stage 1 and 2 children. Post hoc power contrast yielded power estimates ≥.80 for all comparisons. Data are presented as the mean and (±) standard deviation, and aP < .05 was used as a determinant of statistical significance. All analyses were two tailed and conducted with the SPSS software (version 6.1.3 for Windows, SPSS Inc, Chicago, IL).