Published online October 1, 2007
PEDIATRICS Vol. 120 No. 4 October 2007, pp. 814-823 (doi:10.1542/peds.2007-0524)
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow P3Rs: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when P3Rs are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My File Cabinet
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via ISI Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Emonts, M.
Right arrow Articles by Sanders, E. A.M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Emonts, M.
Right arrow Articles by Sanders, E. A.M.
Related Collections
Right arrow Infectious Disease & Immunity

ARTICLE

Genetic Polymorphisms in Immunoresponse Genes TNFA, IL6, IL10, and TLR4 Are Associated With Recurrent Acute Otitis Media

Marieke Emonts, MDa, Reinier H. Veenhoven, MD, PhDb, Selma P. Wiertsema, PhDc, Jeanine J. Houwing-Duistermaat, PhDd, Vanessa Walraven, Bscc, Ronald de Groot, MD, PhDe, Peter W.M. Hermans, PhDe and Elisabeth A.M. Sanders, MD, PhDc

a Department of Pediatrics, Erasmus MC-Sophia Children's Hospital, University Medical Center, Rotterdam, Netherlands
b Department of Pediatrics, Spaarne Hospital Hoofddorp, Hoofddorp, Netherlands
c Department of Pediatric Immunology, University Medical Center Utrecht, Utrecht, Netherlands
d Department of Medical Statistics, Leiden University Medical Center, Leiden, Netherlands
e Department of Pediatrics, Radboud University Nijmegen Medical Center, Nijmegen, Netherlands


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSIONS
 REFERENCES
 
OBJECTIVE. Cytokines and other inflammatory mediators are involved in the pathogenesis of otitis media. We hypothesized that polymorphisms in inflammatory response genes contribute to the increased susceptibility to acute otitis media in otitis-prone children.

PATIENTS AND METHODS. DNA samples from 348 children with ≥2 acute otitis media episodes, who were participating in a randomized, controlled vaccination trial, and 463 healthy adult controls were included. Polymorphisms in TNFA, IL1B, IL4, IL6, IL10, IL8, NOS2A, C1INH, PARP, TLR2, and TLR4 were genotyped. Genotype distributions in children with recurrent acute otitis media were compared with those in controls. Within the patient group, the number of acute otitis media episodes before vaccination and the clinical and immunologic response to pneumococcal conjugate vaccinations were analyzed.

RESULTS. The IL6-174 G/G genotype was overrepresented in children with acute otitis media when compared with controls. In the patient group, TNFA promoter genotypes –238 G/G and –376 G/G and the TLR4 299 A/A genotype were associated with an otitis-prone condition. Furthermore, lower specific anticapsular antibody production after complete vaccination was observed in patients with the TNFA-238 G/G genotype or TNFA-863 A allele carriage. Finally, the IL10-1082 A/A genotype contributed to protection from the recurrence of acute otitis media after pneumococcal vaccination.

CONCLUSIONS. Variation in innate immunoresponse genes such as TNFA-863A, TNFA-376G, TNFA-238G, IL10-1082 A, and IL6-174G alleles in the promoter sequences may result in altered cytokine production that leads to altered inflammatory responses and, hence, contributes to an otitis-prone condition.

Key Words: genotype-phenotype correlation • human • cytokines • inflammation • otitis media

Abbreviations: AOM—acute otitis media • TNFA—tumor necrosis factor A • IL—interleukin • NOS2A—inducible nitric oxide synthase • C1INH—complement component inhibitor-1 • PARP—poly(ADP-ribose) polymerase • TLR—Toll-like receptor • SNP—single-nucleotide polymorphism • OR—odds ratio • rs—reference SNP • IgG—immunoglobulin G

Acute otitis media (AOM) is the most common bacterial infection in children. Overall, 10% to 15% of all children suffer from ≥4 AOM episodes per year, which causes a great disease burden.1 Genetic polymorphisms in immunoresponse genes are known to influence susceptibility to and severity of infectious diseases. For example, allelic variations in TNFA (tumor necrosis factor A), IL1B (interleukin 1B), and IL6 have been associated with meningococcal infection.2 Although cytokines and other inflammatory mediators are also involved in the pathogenesis of otitis media, the role of polymorphisms in immunoresponse genes in recurrent AOM has been relatively unexplored thus far. Increased expression of TNF-{alpha}, IL-1β, IL-6, and IL-10 was observed during experimental otitis media in animals.3,4 Therefore, in a common disease such as otitis media, genetic variations may lead to altered inflammatory responses and an otitis-prone condition. For instance, bacterial endotoxin is recognized by several Toll-like receptors (TLRs), which in turn stimulate TNF-{alpha} production, thus affecting numerous other pathways such as cytokine production, immunoglobulin responses, and mucin production.5–8 Remarkably, IL-1β, IL-6, and TNF-{alpha} levels in nasopharyngeal secretions were found to be lower in children with recurrent otitis media than in healthy children.9

The influence of genetically determined variations on otitis media can be illustrated by twin studies, which have shown a heritability of 57% for acute ear infections and 72% for chronic ear infections.10–14 Correlation for recurrent otitis media is higher in monozygotic twins (65%–71%) compared with dizygotic twins (25%–34%).15 Streptococcus pneumoniae is an important pathogen in otitis media and is involved in at least 20% to 40% of all cases.16–18 Hence, genetic polymorphisms that influence recurrence of otitis media may also be related to response to pneumococcal antigens.

The effect of polymorphisms may result, for instance, from altered expression levels or altered function caused by amino acid substitutions. Variations in immunoresponse genes such as IL10, IL6, and IL4 have been associated with altered cytokine expression levels.19–21 An altered function caused by amino acid substitutions has been reported for polymorphisms in TLR4 and poly(ADP-ribose) polymerase (PARP).22,23 The PARP 762A variant was found recently to be associated with reduced activity after H2O2 exposure, which is known to be present in inflammation.23 Other polymorphisms were selected in this study because of previous associations with infectious or inflammatory diseases such as the IL8 C781T polymorphism, which was reported recently to be associated with bronchiolitis caused by the respiratory syncytial virus.24

In this study, we investigated whether polymorphisms in selected immunoresponse genes may contribute to the recurrence of otitis media and to clinical and immunologic response to pneumococcal vaccination.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Participants
Patients who initially participated in a randomized, controlled study on prevention of recurrent AOM by pneumococcal vaccinations were included.25 Children were enrolled in the study after obtaining approval of the medical ethical committee of the participating hospitals and informed consent from the parents or guardians. DNA was available from 348 white Dutch children, 1 to 7 years of age, who suffered from ≥2 AOM episodes in the preceding year. The number of AOM episodes before vaccination was based on both parental report (AOM was defined as having ≥1 of these symptoms: acute earache, new-onset otorrhea, irritability, and fever) and clinical information of the diagnosis by a physician. Children who did not have AOM episodes were not included, because they were not likely to benefit from vaccination. In the present study cohort, 122 children suffered from 2 to 3 otitis media episodes, whereas 226 children suffered from ≥4 episodes (defined as an otitis-prone condition) (Table 1).26 Children received either pneumococcal vaccinations (n = 168) or control vaccines (ie, hepatitis A [2 years or older] or hepatitis B [younger than 2 years; n = 180 vaccines]). In the pneumococcal vaccine group, 1 dosage of 7-valent conjugate vaccine (Prevnar; Wyeth, Rochester, NY) was administered to children 2 to 7 years of age, whereas 2 dosages were given with a 1-month interval to children of 1 to 2 years of age. In both groups, this procedure was followed after 6 months by 1 dose of 23-valent polysaccharide vaccine (Pneumune, Wyeth). Childrens' progress was followed until 18 months after completion of the vaccine scheme to check for the recurrence of physician-diagnosed AOM.25


View this table:
[in this window]
[in a new window]

  		TABLE 1 Characteristics of Patients With ≥2 AOM Episodes

 
White Dutch adult controls (n = 463) were derived from the Dutch blood bank Sanquin after informed consent was obtained and represented healthy adult donors. No records of previous history regarding AOM were available for these adult controls; however, in the general population, ≤3.2 AOM episodes is expected in childhood.26 Children aged 0 to 13 years had an estimated number of 120 episodes of physician-diagnosed AOM per 1000 person-years in the Netherlands in the period 1995–2003.27 This infers that controls will have experienced, on average, fewer AOM episodes per year than the patients.

Experimental Procedures
Genotyping
Single base extension analysis was used to genotype inducible nitric oxide synthase (NOS2A) S608L (reference single-nucleotide polymorphism [rs] 2297518), PARP V762A (rs1136410), complement component inhibitor-1 (C1INH), V480M (rs4926), IL4 C-524T (rs2243250), IL10 G-1082A (rs1800896), IL10 C-819T (rs3021097), IL1B C-31T (rs1143627), TNFA A-863C (rs1800630), TNFA T-857C (rs1799724), TNFA G-376A (rs3093659), TNFA G-308A (rs1800629), TNFA G-238A (rs361525), IL6 G-174C (rs1800795), IL8 C781T (rs2227306), TLR4 D299G (rs4986790), and TLR4 T399I (rs4986791) (www.ncbi.nlm.nih.gov/SNP). In short, the genomic region of interest was amplified by using polymerase chain reaction. After purification, a single base extension was performed by using a primer ending 1 nucleotide before the single-nucleotide polymorphism (SNP) location. Up to 7 SNPs were analyzed in 1 multiplex assay. A poly-T tail attached to the primer combined with the use of a Liz size marker served to distinguish SNPs in the multiplex analysis (Tables 2 and 3). The TLR2 R753Q polymorphism (rs5743708) was determined by using Taqman analysis with primers TLR2-753F CCATTCCCCAGCGCTTCT and TLR2-753R CCAGGTAGGTCTTGGTGTTCATT and probes TLR2-753V1 VIC-AAGCTGCAGAAGAT and TLR2-753M1 FAM-AAGCTGCGGAAGAT. A subset of polymerase chain reaction samples was sequenced to confirm genotypes. All genotypes were annotated independently by 2 investigators who were blinded to the clinical data.


View this table:
[in this window]
[in a new window]

  		TABLE 2 Polymerase Chain Reaction Primer Sequences

 

View this table:
[in this window]
[in a new window]

  		TABLE 3 Primer Sequences for Single Base Extension Reactions

 
Antibody Measurements
In children with ≥2 AOM episodes, a blood sample was taken for immunologic assessment before and 1 month after complete vaccination. Prevaccination and postvaccination immunoglobulin G (IgG) levels to the 7 pneumococcal serotypes included in the conjugate vaccine were measured in serum by enzyme-linked immunosorbent assay as described previously.28,29

Statistical Analysis
Statistical analysis was performed by using SPSS 11.0 (SPSS Inc, Chicago, IL) and Stata 8 (Stata Corp, College Station, TX). Verification of Hardy-Weinberg equilibrium of genotypes was performed by using the {chi}2 test (1 degree of freedom). Binomial variables were analyzed by using Pearson's {chi}2 test (2 degrees of freedom) or Fisher's exact test when appropriate. Continuous variables were compared for the different genotypes by using the Mann-Whitney U test. When necessary, variables were log-transformed to obtain an approximately normal distribution.

A comparison of genotype frequencies was made between patients and the reference control group. In addition, genotype frequencies in children who suffered from 2 to 3 episodes per year were compared with those of patients who had ≥4 episodes after correction for gender, number of siblings, age, log-transformed age at the time of the first AOM episode, and the interaction term between the latter 2 by using binary logistic regression. Log-transformed age at the first AOM episode was included in the analysis, because an early first infection predisposes to a second AOM episode. A child who has had a first AOM episode at a younger age has had a longer period of time to develop multiple AOM episodes than a child of the same age who suffered from the first infection at a later age. Because the interaction between the age at the first AOM episode and the age of inclusion was significant, it was accounted for in the analyses. Log-transformed antibody levels were compared between individuals with different genotypes. Age, number of AOM episodes (2–3 vs ≥4), and the number of conjugate vaccinations (1 or 2) were included in the analyses that assessed the effect of the different genotypes. Only when genotypes were consistently associated with different serotype-specific antibodies was this association considered relevant.

To determine the involvement of SNPs on the occurrence of AOM after complete vaccination, negative binomial regression was used, because it allows for extra variation (overdispersion). The time of follow-up was measured from 1 month after complete vaccination to the end of the study. Effects were corrected for treatment (antipneumococcal vaccinations or hepatitis vaccinations) and the number of AOM episodes in the year preceding vaccinations (2–3 vs ≥4). P values of ≤.05 were considered to be statistically significant. No correction was made for multiple testing.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 CONCLUSIONS
 REFERENCES
 
We investigated the association between variations in the genes listed in Table 2 and the occurrence of ≥2 episodes of AOM, the number of AOM episodes before vaccination, specific antipneumococcal IgG levels after vaccination, and AOM after complete vaccination, respectively. Only significant associations will be discussed. SNPs not mentioned here showed no significant associations.

Genotype distribution for all SNPs except for the IL10 G-819A polymorphism reached Hardy-Weinberg equilibrium in controls. To rule out technical problems, 14 individuals were typed by using the reverse and forward primer in the single base extension reaction. Results for both strands were identical. Sequencing of 13 random controls also showed identical genotypes, excluding technical errors (data not shown). Genotype distributions in controls are listed in Table 4.


View this table:
[in this window]
[in a new window]

  		TABLE 4 Genotype Distribution of Polymorphisms in White Dutch Controls

 
IL6-174 G/G Genotype Is Associated With Susceptibility to AOM
The number of children with the IL6-174 C/C, IL6-174 C/G, and IL6-174 G/G genotypes in the total cohort of patients with AOM was 49 (14.1%), 156 (45%), and 142 (40.9%), respectively. The corresponding frequencies in controls were 82 (17.8%), 232 (50.4%), and 146 (31.7%), respectively. The IL6-174 G/G genotype was found more frequently in patients with AOM (1014) compared with controls than the C/G genotype (odds ratio [OR]: 1.45; P = .02) or the C/C genotype (OR: 1.64; P = .02).

TNFA Promoter Genotypes –238 G/G and –376 G/G and TLR4 299 D/D Genotype Are Associated With an Otitis-Prone Condition
Similar to other otitis studies, in our study, population risk factors for AOM such as a high number of siblings and low age at first AOM are related to an otitis-prone condition (Table 1).13,30,31 Girls were overrepresented in the group of children who suffered from ≥4 AOM episodes when compared with the children who had 2 to 3 AOM episodes. Children under the age of 4 were more likely to have had ≥4 AOM episodes in the previous year than older children. The interaction of age and age at the first AOM episode was significantly associated with the AOM recurrence rate (P < .01). Therefore, the effect of the polymorphisms on the recurrence rate of AOM was corrected for these factors (Table 5).


View this table:
[in this window]
[in a new window]

  		TABLE 5 Genotype Distribution of TNFA and TLR4 Polymorphisms in Children With AOM

 
The TNFA-238 G/G genotype was overrepresented in the otitis-prone children compared with the children with 2 to 3 AOM episodes (crude OR: 2.13; P = .03; adjusted OR: 2.29; P = .03). Because a difference was observed in the recurrence-rate distribution in children over and under the age of 4 years, these data were also analyzed separately. The association was mainly attributable to children under the age of 4 years.

The TNFA-376 G/G genotype was associated with the otitis-prone condition in children (crude OR: 3.10; P = .05; adjusted OR: 3.06; P = .07). No significant association was found when older and younger children were analyzed separately.

In addition, carriage of the TLR4 299 G allele was associated with a lower number of AOM episodes (OR: 0.5; P = .04). This finding, however, remained significant only after correction for confounding factors when the data for the children under the age of 4 years were analyzed separately (crude OR: 2.50; P = .02; adjusted OR: 2.49; P = .03).

TNFA-863 C/C Genotype and Carriage of the TNFA-238 A Allele Are Associated With Higher Specific Antipneumococcal IgG Levels After Complete Vaccination
IgG antipneumococcal antibody levels were evaluated in 80 children who were in the pneumococcal vaccine group: 34 were aged 12 to 24 months and 46 were aged 25 to 84 months. Four or more AOM episodes in the year preceding inclusion were observed in 36 children, whereas 44 had 2 to 3 episodes of AOM. Before vaccination, all IgG antipneumococcal antibody levels were low for patients with 2 to 3 and ≥4 AOM episodes (Table 6). Serum IgG antipneumococcal antibody levels against all serotypes were lower in the children with an AOM recurrence rate ≥4 compared with those with only 2 to 3 AOM episodes after complete vaccination. This was significant for all except the anti–serotype 6B and 23F antibody levels. Age, independent from the number of AOM episodes (2–3 or ≥4), had a significant effect on specific IgG levels against serotype 14 at baseline, and on anti–serotype 4 antibody levels after vaccination. By using a logistic regression model adjusting for age, number of AOM episodes, and number of conjugate vaccinations, a significantly lower antipneumococcal serotype 23F antibody level was observed for the carriers of the TNFA-863 A allele compared with children homozygous for the C allele (P < .001). Furthermore, a trend for lower specific IgG levels was observed against 5 of 7 vaccine serotypes (P = .05–.10) in the carriers of the 863A allele. The TNFA-238 A allele carriers had higher geometric mean specific IgG levels against all serotypes (Table 7). This finding, however, was only significant for antibodies against pneumococcal serotypes 18C and 19F without correction for confounding factors (P = .04 and .04, respectively).


View this table:
[in this window]
[in a new window]

  		TABLE 6 Geometric Mean (95% Confidence Interval) of Specific Antipneumococcal IgG in Children With 2 to 3 AOM Episodes and Children With ≥4 AOM Episodes Before Vaccination and 1 Month After Complete Vaccination

 

View this table:
[in this window]
[in a new window]

  		TABLE 7 Geometric Mean (95% Confidence Interval) of Specific Antipneumococcal Antibodies 1 Month After Complete Vaccination for Different TNFA-863 and TNFA-238 Genotypes

 
No significant differences in specific IgG levels were observed for the IL6-174 G/C and the IL10-1082 G/A and IL10-819 C/T genotypes (data not shown).

IL10-1082 A/A Genotype Is Associated With Protection From AOM Recurrence After Vaccination
Previously, we have reported that the number of AOM episodes in the per-protocol analysis was higher in the pneumococcal vaccine group than in the control vaccine group, particularly among children who suffered ≥4 AOM episodes in the year preceding inclusion.25 We corrected for this feature to assess whether the polymorphisms were correlated to the number of AOM episodes after complete vaccination. Patient characteristics did not differ between the pneumococcal and control vaccine group.25 We observed that the IL10-1082 A/A genotype protects patients from AOM recurrence during follow-up after vaccination (incidence rate ratio: 0.63; P = .01).

No significant differences were observed for polymorphisms in TNFA or IL6 (data not shown).


   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
CONCLUSIONS
 REFERENCES
 
In this study, we found an association between TNFA promoter polymorphisms and otitis-prone condition and specific IgG production after pneumococcal vaccination. The TNFA-238 G/G genotype was associated with the otitis-prone condition and a trend for lower specific antipneumococcal antibody levels after vaccinations compared with carriers of the A allele. The TNFA-863 A allele was also associated with a trend for lower specific antipneumococcal IgG levels compared with children with the TNFA-863 C/C genotype. The TNFA-376 G/G genotype was also associated with an otitis-prone condition. Similar to Joki-Ekkila et al32, we found no association between the TNFA-308 promoter polymorphism and recurrent AOM. In a recent study, an association was reported between carriage of the rare TNFA-308 allele and susceptibility to AOM. The allele frequencies of the TNFA-308 polymorphism, however, differed from what is usually reported for this polymorphism.33 Differences in the observed associations between the TNFA promoter polymorphisms may, indeed, result from differences in allele frequency in the population and the effect of haplotypes. This finding may be specifically true for rare polymorphisms such as the TNFA-376 G/A polymorphism. For our study, however, the limited number of patients prohibited haplotype analysis.

TNF-{alpha} levels in nasopharyngeal secretions are decreased in children with recurrent otitis media compared with healthy children.9 TNF-{alpha} stimulates Ig and mucin production, and low TNF-{alpha} concentrations may compromise these defense mechanisms.7 The association between various TNFA polymorphisms and otitis media parameters found in our study may indicate that, indeed, there is a role for these polymorphisms in TNF-{alpha} production in vivo. In the recent past, numerous studies have been performed to investigate the association of TNFA promoter polymorphisms and TNF-{alpha} levels in different inflammatory and infectious diseases, and contradictory results have been reported34. TNF-{alpha} expression is probably not determined by one polymorphism but, rather, by a combination of polymorphisms in TNFA and TNFA-associated genes. Different pathogens may induce a variety of cytokine responses and, because numerous pathogens, both bacterial and viral, are known to cause otitis media, unraveling the role of polymorphisms on TNF-{alpha} production in the human setting is very difficult. Because TNF-{alpha} levels are expected to change during the course of infection, the timing of sampling is likely to be a very important determinant of the results.

In addition, the IL6-174 G/G promoter genotype was found more frequently in patients with AOM than in healthy adult controls in our study. Our findings support the findings of others (eg, the study by Nieters et al35) who found homozygosity of the IL6-174C allele to be associated with a lower frequency of reported common colds. Common colds are known to predispose for recurrent otitis media. In addition, Patel et al33 reported IL6-174 G allele carriage to be increased in otitis-media-susceptible children. The IL6 G/G genotype was shown previously to be associated with high IL-6 levels compared with the C/C genotype21. This association, however, is not consistent, and a more complex regulation of IL-6 production that depends on multiple polymorphisms in the IL6 promoter region seems to play a role.36,37 Furthermore, IL-6 expression is influenced by TNF-{alpha}, and the interaction of polymorphisms in these and other genes may codetermine the phenotype.

Carriage of the TLR4 299 G allele was associated with a lower number of AOM episodes but was significant only in children younger than 4 years after corrections for confounding factors. Possibly, a low G allele frequency in our population (10% in the group with 2–3 AOM episodes versus 5% in the otitis-prone group) hampered identification of an association. TLRs recognize microbial patterns in a specific way. It is thought that, depending on the microorganism involved, a combination of TLRs is triggered, which determines the direction of the immune response.38 Detailed information on the causative pathogens in each disease episode is needed to elucidate the precise role of TLRs and their genetic variation in AOM and other diseases. Unfortunately, these data are not available in our study.

The IL10-1082 A/A genotype was associated with protection from AOM after vaccination. The IL10 promoter haplotype, which includes the IL10-1082 A/A genotype, is associated with low IL-10 production.19,39,40 For the IL10-819 C/C genotype, which is in the same haplotype, a similar trend was observed (data not shown). In IL-10-deficient mice immunized with nonvirulent unencapsulated Streptococcus pneumoniae (strain R36A), elevated induction of proinflammatory cytokines was observed, which supports the hypothesis that low IL-10 producers confer better response after vaccination. Antibody titers against pneumococcal proteins were increased compared with those in wild-type mice.41 Although no association was observed between the IL10 polymorphism and specific antibody levels in our population, one might expect a similar effect. Possibly, the concentration of IL-10 in low producers is sufficient to preclude finding differences in antibody titers.

Because otitis media is a multifactorial disease, the effect of each polymorphism on its own is expected to be limited. In addition, we are aware that most of these associations are expected to lose significance after correction for multiple testing. However, because no consensus has been reached on what method to use to correct for multiple testing in genetic-association studies, we felt it most appropriate to provide P values as they are.

The associations in our study were attributable mainly to children younger than 4 years. Several factors may explain this finding. First, a selection for children suffering from ≥2 episodes of otitis media for the vaccination trial may have resulted in a biased group in the older children, including those children with the highest recurrence rates or ongoing infection. Second, the immune system and anatomy, like the Eustachian tube, of young children are both still developing and differ from older children and adults, which likely results in a more prominent role for innate immunity at younger age. In contrast to previous studies, our study only included patients with recurrent AOM and no age-matched controls without otitis were included.30,42


   CONCLUSIONS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSIONS
REFERENCES
 
We have shown that several polymorphic variants in immunoresponse genes (ie, IL6-174 G/C, TNFA-863 A/C, TNF-376 G/A, TNFA-238 G/A, TLR4 D/G, and IL10-1082 G/A) are suggested to have a potential influence on middle-ear infections. Because the various genotypes are expected to interact with each other and numerous environmental and host factors, additional functional and genetic studies are warranted to elucidate their individual contributions to the recurrence of AOM.


   ACKNOWLEDGMENTS
 
This study was supported by Erasmus MC Revolving Fund Foundation grant RF 2001/24. The Sanquin blood bank provided samples from healthy blood donors.

We thank Jon Laman (Department of Immunology, Erasmus MC, Rotterdam) for critically reading the manuscript.


   FOOTNOTES
 
Accepted Apr 26, 2007.

Address correspondence to Marieke Emonts, MD, Department of Pediatrics, Erasmus MC-Sophia Children's Hospital, University Medical Center, Dr Molewaterplein 50, Room Ee15-02, 3015 GE, Rotterdam, Netherlands. E-mail: m.emonts{at}erasmusmc.nl

The authors have indicated that they have no financial relationships relevant to this article to disclose.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSIONS
 REFERENCES
 

  1. Alho OP, Koivu M, Sorri M. What is an "otitis-prone" child? Int J Pediatr Otorhinolaryngol. 1991;21 :201 –209[CrossRef][ISI][Medline]
  2. Emonts M, Hazelzet JA, de Groot R, Hermans PW. Host genetic determinants of Neisseria meningitidis infections. Lancet Infect Dis. 2003;3 :565 –577[CrossRef][ISI][Medline]
  3. Long JP, Tong HH, Shannon PA, DeMaria TF. Differential expression of cytokine genes and inducible nitric oxide synthase induced by opacity phenotype variants of Streptococcus pneumoniae during acute otitis media in the rat. Infect Immun. 2003;71 :5531 –5540[Abstract/Free Full Text]
  4. Melhus A, Ryan AF. Expression of cytokine genes during pneumococcal and nontypeable Haemophilus influenzae acute otitis media in the rat. Infect Immun. 2000;68 :4024 –4031[Abstract/Free Full Text]
  5. Kohase M, Henriksen-DeStefano D, May LT, Vilcek J, Sehgal PB. Induction of beta 2-interferon by tumor necrosis factor: a homeostatic mechanism in the control of cell proliferation. Cell. 1986;45 :659 –666[CrossRef][ISI][Medline]
  6. Dinarello CA, Cannon JG, Wolff SM, et al. Tumor necrosis factor (cachectin) is an endogenous pyrogen and induces production of interleukin 1. J Exp Med. 1986;163 :1433 –1450[Abstract/Free Full Text]
  7. Lin J, Kim Y, Juhn SK. Increase of mucous glycoprotein secretion by tumor necrosis factor alpha via a protein kinase C-dependent mechanism in cultured chinchilla middle ear epithelial cells. Ann Otol Rhinol Laryngol. 1998;107 :213 –219[ISI][Medline]
  8. Kehrl JH, Miller A, Fauci AS. Effect of tumor necrosis factor alpha on mitogen-activated human B cells. J Exp Med. 1987;166 :786 –791[Abstract/Free Full Text]
  9. Lindberg K, Rynnel-Dagoo B, Sundqvist KG. Cytokines in nasopharyngeal secretions: evidence for defective IL-1 beta production in children with recurrent episodes of acute otitis media. Clin Exp Immunol. 1994;97 :396 –402[ISI][Medline]
  10. Casselbrant ML, Mandel EM. Genetic susceptibility to otitis media. Curr Opin Allergy Clin Immunol. 2005;5 :1 –4[Medline]
  11. Casselbrant ML, Mandel EM, Fall PA, et al. The heritability of otitis media: a twin and triplet study. JAMA. 1999;282 :2167 –2169[Free Full Text]
  12. Casselbrant ML, Mandel EM, Rockette HE, et al. The genetic component of middle ear disease in the first 5 years of life. Arch Otolaryngol Head Neck Surg. 2004;130 :273 –278[Abstract/Free Full Text]
  13. Kvaerner KJ, Tambs K, Harris JR, Magnus P. Distribution and heritability of recurrent ear infections. Ann Otol Rhinol Laryngol. 1997;106 :624 –632[ISI][Medline]
  14. Rovers M, Haggard M, Gannon M, Koeppen-Schomerus G, Plomin R. Heritability of symptom domains in otitis media: a longitudinal study of 1,373 twin pairs. Am J Epidemiol. 2002;155 :958 –964[Abstract/Free Full Text]
  15. Kvestad E, Kvaerner KJ, Roysamb E, Tambs K, Harris JR, Magnus P. Otitis media: genetic factors and sex differences. Twin Res. 2004;7 :239 –244[CrossRef][ISI][Medline]
  16. Bluestone CD, Stephenson JS, Martin LM. Ten-year review of otitis media pathogens. Pediatr Infect Dis J. 1992;11(suppl 8) :7 –11
  17. Del Beccaro MA, Mendelman PM, Inglis AF, et al. Bacteriology of acute otitis media: a new perspective. J Pediatr. 1992;120 :81 –84[CrossRef][ISI][Medline]
  18. Kilpi T, Herva E, Kaijalainen T, Syrjanen R, Takala AK. Bacteriology of acute otitis media in a cohort of Finnish children followed for the first two years of life. Pediatr Infect Dis J. 2001;20 :654 –662[CrossRef][ISI][Medline]
  19. Turner DM, Williams DM, Sankaran D, Lazarus M, Sinnott PJ, Hutchinson IV. An investigation of polymorphism in the interleukin-10 gene promoter. Eur J Immunogenet. 1997;24 :1 –8[ISI][Medline]
  20. Rosenwasser LJ, Borish L. Genetics of atopy and asthma: the rationale behind promoter-based candidate gene studies (IL-4 and IL-10). Am J Respir Crit Care Med. 1997;156(suppl 4) :152 –155
  21. Fishman D, Faulds G, Jeffery R, et al. The effect of novel polymorphisms in the interleukin-6 (IL-6) gene on IL-6 transcription and plasma IL-6 levels, and an association with systemic-onset juvenile chronic arthritis. J Clin Invest. 1998;102 :1369 –1376[ISI][Medline]
  22. Arbour NC, Lorenz E, Schutte BC, et al. TLR4 mutations are associated with endotoxin hyporesponsiveness in humans. Nat Genet. 2000;25 :187 –191[CrossRef][ISI][Medline]
  23. Lockett KL, Hall MC, Xu J, et al. The ADPRT V762A genetic variant contributes to prostate cancer susceptibility and deficient enzyme function. Cancer Res. 2004;64 :6344 –6348[Abstract/Free Full Text]
  24. Hull J, Ackerman H, Isles K, et al. Unusual haplotypic structure of IL8, a susceptibility locus for a common respiratory virus. Am J Hum Genet. 2001;69 :413 –419[CrossRef][ISI][Medline]
  25. Veenhoven R, Bogaert D, Uiterwaal C, et al. Effect of conjugate pneumococcal vaccine followed by polysaccharide pneumococcal vaccine on recurrent acute otitis media: a randomised study. Lancet. 2003;361 :2189 –2195[CrossRef][ISI][Medline]
  26. Faden H, Duffy L, Boeve M. Otitis media: back to basics. Pediatr Infect Dis J. 1998;17 :1105 , 1113[CrossRef][ISI][Medline]
  27. Plasschaert AI, Rovers MM, Schilder AG, Verheij TJ, Hak E. Trends in doctor consultations, antibiotic prescription, and specialist referrals for otitis media in children: 1995–2003. Pediatrics. 2006;11 :1879 –1886
  28. Veenhoven R, van Kempen MJ, Wiertsema SP, et al. Immunogenicity of combined pneumococcal conjugate and polysaccharide vaccination in children with recurrent AOM. Presented at: 5th Extraordinary International Symposium on Recent Advances in Otitis Media, OM2005; April 24–27,2005; Amsterdam, Netherlands
  29. Musher DM, Luchi MJ, Watson DA, Hamilton R, Baughn RE. Pneumococcal polysaccharide vaccine in young adults and older bronchitics: determination of IgG responses by ELISA and the effect of adsorption of serum with non-type-specific cell wall polysaccharide. J Infect Dis. 1990;161 :728 –735[ISI][Medline]
  30. Harsten G, Prellner K, Heldrup J, Kalm O, Kornfalt R. Recurrent acute otitis media: a prospective study of children during the first three years of life. Acta Otolaryngol. 1989;107 :111 –119[Medline]
  31. Rovers MM, Schilder AG, Zielhuis GA, Rosenfeld RM. Otitis media. Lancet. 2004;363 :465 –473[CrossRef][ISI][Medline]
  32. Joki-Erkkila VP, Puhakka H, Hurme M. Cytokine gene polymorphism in recurrent acute otitis media. Arch Otolaryngol Head Neck Surg. 2002;128 :17 –20[Abstract/Free Full Text]
  33. Patel JA, Nair S, Revai K, et al. Association of proinflammatory cytokine gene polymorphisms with susceptibility to otitis media. Pediatrics. 2006;118 :2273 –2279[Abstract/Free Full Text]
  34. Bayley JP, Ottenhoff TH, Verweij CL. Is there a future for TNF promoter polymorphisms? Genes Immun. 2004;5 :315 –329[CrossRef][ISI][Medline]
  35. Nieters A, Brems S, Becker N. Cross-sectional study on cytokine polymorphisms, cytokine production after T-cell stimulation and clinical parameters in a random sample of a German population. Hum Genet. 2001;108 :241 –248[CrossRef][ISI][Medline]
  36. Schluter B, Raufhake C, Erren M, et al. Effect of the interleukin-6 promoter polymorphism (-174 G/C) on the incidence and outcome of sepsis. Crit Care Med. 2002;30 :32 –37[CrossRef][ISI][Medline]
  37. Terry CF, Loukaci V, Green FR. Cooperative influence of genetic polymorphisms on interleukin 6 transcriptional regulation. J Biol Chem. 2000;275 :18138 –18144[Abstract/Free Full Text]
  38. Mukhopadhyay S, Herre J, Brown GD, Gordon S. The potential for Toll-like receptors to collaborate with other innate immune receptors. Immunology. 2004;112 :521 –530[CrossRef][ISI][Medline]
  39. Lim S, Crawley E, Woo P, Barnes PJ. Haplotype associated with low interleukin-10 production in patients with severe asthma. Lancet. 1998;352 :113[CrossRef][ISI][Medline]
  40. Crawley E, Kay R, Sillibourne J, Patel P, Hutchinson I, Woo P. Polymorphic haplotypes of the interleukin-10 5' flanking region determine variable interleukin-10 transcription and are associated with particular phenotypes of juvenile rheumatoid arthritis. Arthritis Rheum. 1999;42 :1101 –1108[CrossRef][ISI][Medline]
  41. Khan AQ, Shen Y, Wu ZQ, Wynn TA, Snapper CM. Endogenous pro- and anti-inflammatory cytokines differentially regulate an in vivo humoral response to Streptococcus pneumoniae. Infect Immun. 2002;70 :749 –761[Abstract/Free Full Text]
  42. Rovers MM, Zielhuis GA, Ingels K, van der Wilt GJ. Day-care and otitis media in young children: a critical overview. Eur J Pediatr. 1999;158 :1 –6[CrossRef][ISI][Medline]
PEDIATRICS (ISSN 1098-4275). ©2007 by the American Academy of Pediatrics



This article has been cited by other articles:


Home page
 Clin. Microbiol. Rev.Home page
R. Janssen, K. A. Krogfelt, S. A. Cawthraw, W. van Pelt, J. A. Wagenaar, and R. J. Owen
Host-Pathogen Interactions in Campylobacter Infections: the Host Perspective
Clin. Microbiol. Rev., July 1, 2008; 21(3): 505 - 518.
[Abstract] [Full Text] [PDF]

Home page
 JAMAHome page
T. L. Cheng, R. D. Cohn, and G. J. Dover
The Genetics Revolution and Primary Care Pediatrics
JAMA, January 30, 2008; 299(4): 451 - 453.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow P3Rs: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when P3Rs are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My File Cabinet
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via ISI Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Emonts, M.
Right arrow Articles by Sanders, E. A.M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Emonts, M.
Right arrow Articles by Sanders, E. A.M.
Related Collections
Right arrow Infectious Disease & Immunity