Cytokine and Cellular Inflammatory Sequence in Enteroviral Meningitis
* Departments of Pediatrics
Microbiology, Fukushima Medical University, School of Medicine, Fukushima, Japan
Jyusendo General Hospital, Koriyama, Japan
 |
ABSTRACT |
|---|
 TOP ABSTRACT METHODSRESULTSDISCUSSIONMcFARLANE'S INSIGHTREFERENCES |
|---|
Objective. To clarify the sequence of cytokines and inflammatory cells in enteroviral meningitis.
Methods. Cerebrospinal fluid (CSF) was collected from 86 patients who received a diagnosis of enteroviral meningitis after detection of the enteroviral genome in the CSF using polymerase chain reaction. Twenty-one of 86 patients had repeated lumbar punctures. Cytokine concentrations were measured acutely and in 32 samples collected during recovery.
Results. The proinflammatory cytokines (interleukin [IL]-6, IL-8, and interferon-
) were detected at significantly higher concentrations during the acute phase when enteroviral genomes were present. Proinflammatory cytokines decreased to normal levels in the recovery phase when enteroviral genomes disappeared. Anti-inflammatory concentrations (IL-10 and transforming growth factor-ß1) were significantly higher in the recovery phase than in the acute phase. Of the 86 CSF samples collected in the acute phase, 11 had no pleocytosis (<10 white blood cells/mm3). In 7 of those 11 CSF samples, IL-6 and IL-8 levels were as high as those in the 75 samples with pleocytosis (
10 white blood cells/mm3). Seven patients were considered to be in the initial stage of their illness when production of proinflammatory cytokines were high but leukocytes had not yet infiltrated the cerebrospinal cavity.
Conclusions. The inflammatory process observed in human enteroviral meningitis is comparable with that observed in animal models: 1) infection induces proinflammatory cytokine production, followed by infiltration of white blood cells into the infected area, and 2) inflammation is terminated by the anti-inflammatory cytokines that are produced when pathogens are eliminated.
Key Words: viral meningitis • enterovirus • cytokine • inflammatory cells
Abbreviations: WBC, white blood cell • IL, interleukin • TNF, tumor necrosis factor • IFN, interferon • TGF, transforming growth factor • CSF, cerebrospinal fluid • PCR, polymerase chain reaction • ELISA, enzyme-linked immunosorbent assay
Inflammation is initiated by local production of several soluble mediators. Many different cytokines and chemokines control the inflammatory response via activation and migration of white blood cells (WBCs).1 The physiologic functions of those cytokines were inferred from the biological activity observed in vitro2,3 and confirmed by in vivo experiments.4–6 The results of those experiments indicated that the production of proinflammatory cytokines (interleukin [IL]-1ß, tumor necrosis factor [TNF]-
, IL-6, and interferon [IFN]-) stimulated by infection induce the migration of WBCs into the infected area and that inflammation is terminated by anti-inflammatory cytokines (IL-10, IL-4, and transforming growth factor (TGF)-ß1) that are produced after elimination of the microorganisms. In humans, however, the induction of inflammation by cytokines at the initial stage of infection has not been demonstrated.
In the present study, we measured the concentrations of several proinflammatory and anti-inflammatory cytokines in the cerebrospinal fluid (CSF) of patients with naturally occurring enteroviral meningitis in the acute and recovery phases and deduce the role of cytokines in the inflammatory process.
|
METHODS |
|---|
|
TOPABSTRACTMETHODSRESULTSDISCUSSIONMcFARLANE'S INSIGHTREFERENCES |
|---|
Samples
We observed an outbreak of viral meningitis caused by echovirus type 30 from June to December 1997. CSF samples were collected from 86 patients with signs and symptoms suggestive of meningeal involvement at Jyusendo General Hospital in the Fukushima Prefecture, Japan. CSF samples were transferred to the Department of Pediatrics, Fukushima Medical University, immediately after collection and stored at –80°C until use. All 86 patients received a diagnosis of enteroviral meningitis after detection of the enteroviral genome in the CSF using polymerase chain reaction (PCR; Table 1). Of the 86 patients, 48 had neutrophil-predominant pleocytosis (
10 WBCs/mm3), 27 had lymphocyte-predominant pleocytosis, and the remaining 11 had no pleocytosis (<10 WBCs/mm3) in the CSF. In Jyusendo General Hospital, repeated lumbar punctures were performed to confirm decreasing CSF WBC counts (<50 WBCs/mm3) as a marker of the end of inflammation in the central nervous system. Parents of 21 patients with pleocytosis in the CSF in the acute phase consented to repeated lumbar punctures to confirm sufficiently decreasing WBCs in the CSF (Table 1). Twenty-one patients had 2 lumbar punctures, 9 patients had 3, and 2 patients had 4. Of the 21 patients who received multiple lumbar punctures, there was no detectable enteroviral genome in 32 of the CSF samples using PCR, and all 21 patients therefore were considered to be collected in the recovery phase, although pleocytosis remained in 20 of the samples. No differences were observed in the characteristics of these 21 patients and the other 65 patients (Table 1). CSF samples collected from 14 patients with acute leukemia in complete remission during the same period were used as controls. Informed consent was obtained from patients or their parents for cytokine concentration measurements in the CSF samples collected. The ethics committee in Jyusendo General Hospital approved the study.
|
PCR
Nested PCR was performed for detection of the enterovirus in the CSF as described previously.7 Primer sequences used in this study were F1 (CAAGCACTTCTGTTTCCCCGG), F2 (TCCTCCGGCCCCTGAATGCG), and R1 (ATTGTCCACCATAAGCAGCCA) for the enterovirus. RNA was extracted from 250 µL of whole CSF using an RNA extraction kit (Nippon Gene, Tokyo, Japan). After RNA extraction, cDNA was synthesized (42°C, 30 minutes) from the resuspended RNA using 2.5 U of Moloney murine leukemia virus reverse transcriptase (Toyobo, Osaka, Japan) and reaction mixture containing 50 mM KCl, 10 mM TRIS-HCl (pH 8.3), 5 mM MgCl2, 0.2 mM each dNTP, 1 µmol each of primer F1 and primer R1, and 20 U of RNase inhibitor (Toyobo). The cDNA product was amplified in 50 µL of reaction mixture containing 50 mM KCl, 10 mM TRIS-HCl (pH 8.3), 5 mM MgCl2, 0.2 mM each dNTP, 0.2 µmol each of primer F1 and primer R1, and 1.25 U of Taq DNA polymerase (Perkin-Elmer, Norwalk, CT). Thirty cycles were performed in a thermal cycler (Perkin-Elmer) as follows: denaturation for 1 minute at 93°C, annealing for 1 minute at 55°C, and extension for 2 minutes at 72°C. The second PCR was performed as above, using the second primer pair (F2 and R1) and 2 µL of the first PCR product. The nested PCR product was run on a 2% agarose gel containing ethidium bromide and photographed under ultraviolet light. To eliminate and detect laboratory contamination leading to false-positive PCR results, negative controls were included for each step of the assay.
Cytokine Assay
IL-6, IL-8, IFN-, IL-10, and TGF-ß1 concentrations in the CSF samples were determined using monoclonal antibody enzyme-linked immunosorbent assay (ELISA) kits (IL-6 ELISA, IL-8 ELISA, IFN- ELISA, and IL-10 ELISA; Endogen, Inc, Woburn, MA; and TGF-ß1 ELISA, R & D Systems, Minneapolis, MN). The minimum detectable concentrations were 1 pg/mL (IL-6), 2 pg/mL (IL-8), 2 pg/mL (IFN-), 3 pg/mL (IL-10), and 7 pg/mL (TGF-ß1). The intra- and interassay coefficients were <10%. We measured the concentrations of proinflammatory cytokines (IL-6, IL-8, and IFN-) and anti-inflammatory cytokines (IL-10 and TGF-ß1) in 21 CSF samples in the acute phase and 32 CSF samples in the recovery phase collected from 21 patients who received repeated lumbar punctures. IL-6 and IL-8 concentrations were also measured in 65 CSF samples collected from patients with enteroviral meningitis in the acute phase and 14 control CSF samples obtained from patients with leukemia. The cytokine concentration in the CSF samples that was below the detectable limit of the ELISA kit was defined as 100 pg/mL for statistical analysis.
Statistical Analysis
Wilcoxon rank-sum test was used for the data analysis. P < .05 was considered to be significant.
|
RESULTS |
|---|
|
TOPABSTRACTMETHODSRESULTSDISCUSSIONMcFARLANE'S INSIGHTREFERENCES |
|---|
Sequential Appearance of Proinflammatory and Anti-inflammatory Cytokines in the CSF
We compared the concentrations of several cytokines in the CSF samples collected during the acute and recovery phases from 21 patients who received repeated lumbar punctures. The CSF concentrations in the acute phase were calculated to be log (2.48 ± 0.55) pg/mL (IL-6), log (3.12 ± 0.52) pg/mL (IL-8), and log (1.80 ± 0.39) pg/mL (IFN-
). Those in the recovery phase were calculated to be log (0.39 ± 0.43) pg/mL (IL-6), log (1.13 ± 0.28) pg/mL (IL-8), and log (0.49 ± 0.41) pg/mL (IFN-). The proinflammatory cytokine concentrations in the acute phase were significantly higher than those in the recovery phase (IL-6: P < .0001, IL-8: P < .0001, IFN-: P < .0001; Fig 1). The IL-10 and TGF-ß1 concentrations in the CSF in the acute phase were calculated to be log (0.51 ± 0.48) pg/mL (IL-10) and log (0.43 ± 0.48) pg/mL (TGF-ß1). Those in the recovery phase were calculated to be log (1.19 ± 0.61) pg/mL (IL-10) and log (1.22 ± 0.45) pg/mL (TGF-ß1). The anti-inflammatory cytokine concentrations in the recovery phase were significantly higher than those in the acute phase (IL-10: P = .0206, TGF-ß1: P = .0003; Fig 2).
|
, samples (n = 32) with PCR-negative results collected in the recovery phase of enteroviral meningitis. a, IL-6 levels in the acute phase were significantly higher than in the recovery phase (P < .0001). b, IL-8 levels in the acute phase were significantly higher than in the recovery phase (P < .0001). c, IFN-
|
Correlation Among Proinflammatory Cytokines, Enteroviral Genome, and Pleocytosis in the CSF
IL-6 and IL-8 concentrations in the CSF samples taken from 14 leukemia patients were calculated to be log (0.77 ± 0.26) pg/mL and log (0.50 ± 0.48) pg/mL, respectively. The cutoff levels of IL-6 and IL-8 were defined as log 1.51 pg/mL and log 1.93 pg/mL (mean + 3 standard deviations), respectively. Eighty-six patients who had a diagnosis of enteroviral meningitis in the acute phase after detecting enteroviral RNA in their CSF samples using PCR were classified into 3 groups; 48 patients with neutrophil-predominant pleocytosis (
10 WBCs/mm3), 27 patients with lymphocyte-predominant pleocytosis, and 11 patients without pleocytosis (<10 WBCs/mm3) in the CSF. IL-6 levels of those groups were log (2.53 ± 0.51) pg/mL, log (2.33 ± 0.58) pg/mL, and log (1.80 ± 1.00) pg/mL, respectively, and were higher than the cutoff level in 46 (95.8%), 26 (96.3%), and 7 (63.6%) patients, respectively. The IL-8 levels were calculated to be log (3.12 ± 0.51) pg/ml, log (2.83 ± 0.59) pg/ml, and log (2.21 ± 0.87) pg/ml, respectively, and were higher than the cutoff level in 48 (100%), 25 (92.6%), and 7 (63.6%) patients, respectively. In 7 of the 11 CSF samples with normal CSF cell counts, both IL-6 and IL-8 levels were above the cutoff levels (Fig 3). Thirty-two CSF samples collected from 21 patients in the recovery phase were classified into 2 groups; 20 samples with pleocytosis and 12 samples without. IL-6 concentrations of those samples were calculated to be log (0.46 ± 0.46) pg/mL and log (0.26 ± 0.35) pg/mL, respectively. The concentrations of IL-8 were calculated to be log (1.09 ± 0.30) pg/mL and log (1.19 ± 0.25) pg/mL, respectively. The concentrations of IL-6 and IL-8 in the CSF in the recovery phase were lower than the cutoff levels in all samples.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTMETHODSRESULTSDISCUSSIONMcFARLANE'S INSIGHTREFERENCES |
|---|
In experimentally infected animal models of pleuritis,6 peritonitis,4 or meningitis,5 samples without blood contamination or tissue effusion were obtained from the inflamed area. The cytokine concentrations in the samples reflect the amount of cytokines produced by the infected tissue. In these reports, proinflammatory cytokines such as TNF-
, IL-1, and IL-6 were detected in the initial phase (1–2 hours after infection) and reached a maximum 3 to 5 hours after infection. The proinflammatory cytokines attracted WBCs with neutrophil predominance and induced increased exudation in the pleural cavity6 or increased protein concentration in the CSF.5 Thereafter, anti-inflammatory cytokines, including IL-108,9 and TGF-ß1,10 which are produced shortly after the production of proinflammatory cytokines, suppressed the activities of the proinflammatory cytokines.
In bacterial meningitis in humans, inflammation in the acute phase is thought to be caused by the production of proinflammatory cytokines, including TNF-, IL-6, and IL-8, in the cerebrospinal cavity. Anti-inflammatory cytokines, including IL-10 and TGF-ß1, were also detected in the CSF samples in the acute phase. Those cytokines might contribute to end the inflammation, as the administration of dexamethasone inhibited the production of proinflammatory cytokines and decreased the incidence of hearing impairment.11,12 In viral meningitis in humans, IL-6, IL-8, and IFN- were detected at relatively high concentrations.13–16 Anti-inflammatory cytokines were also detected in the CSF in the early stages of the illness.17,18 It has been inferred that those cytokines might play an important role in the inflammatory process in viral meningitis. The sequential appearance of proinflammatory cytokines, WBCs, and anti-inflammatory cytokines in the CSF after viral infection, however, is not clear.
A regional epidemic of enteroviral meningitis caused by echovirus type 30 was observed in our district from June to December 1997. To investigate the role of cytokines in the inflammation of viral meningitis, we measured the concentrations of proinflammatory cytokines (IL-6, IL-8, and IFN-) and anti-inflammatory cytokines (IL-10 and TGF-ß1) in the CSF samples collected from patients with confirmed enteroviral meningitis in the acute and recovery phases. The levels of proinflammatory cytokines were high in the acute phase, when the viral genome was detected in the CSF, and decreased to normal levels in the recovery phase, when the virus disappeared from central nervous system. Anti-inflammatory cytokines were produced in the recovery phase. These results indicate that the main immunologic response by the cytokine network shifts from production of proinflammatory cytokines to that of anti-inflammatory cytokines during or after the period when the virus is eliminated from the cerebrospinal cavity.
In viral meningitis, WBCs infiltrate the cerebrospinal cavity with neutrophil predominance at an early stage of the illness; thereafter, lymphocytes become the predominant cells. A few reports demonstrated enteroviral meningitis without pleocytosis.19,20 This was considered the initial stage of the illness when WBCs had not infiltrated the cerebrospinal cavity.19 We suggest that the acute phase of enteroviral meningitis may be divided into 3 time periods: the period without pleocytosis, the period with neutrophil-predominant pleocytosis, and the period with lymphocyte-predominant pleocytosis. Seven (63.6%) of 11 samples collected from patients without pleocytosis in the CSF in the acute phase had high concentrations of both IL-6 and IL-8, as did 75 samples collected from patients with pleocytosis in the acute phase. Those 7 patients could be considered to be in the initial stage of illness when virus is present and when WBCs have not yet infiltrated the cerebrospinal cavity. The other 4 patients with enteroviral genome and normal CSF cytokine level might be considered to be at slightly earlier stage immediately after viral infection.
The results observed in this study suggest a possible sequence of events. Immediately after viral infection, proinflammatory cytokines such as IL-6, IL-8, and IFN- are produced by endothelial cells, arachnoid cells, and/or monocytes.21 These proinflammatory cytokines attract WBCs into the cerebrospinal cavity. After elimination of virus, the proinflammatory period is terminated by the production of anti-inflammatory cytokines produced by activated T cells and/or monocytes.21 This sequence of events that we have observed in viral meningitis in humans is comparable to that observed in animal models.4–6 Our observations suggest that the inflammatory process in viral meningitis is regulated by the production of cytokines produced in a sequence.
|
McFARLANE’S INSIGHT |
|---|
|
TOPABSTRACTMETHODSRESULTSDISCUSSIONMcFARLANE'S INSIGHTREFERENCES |
|---|
" ... Since only 20 of 55 (36%) new fellows of the Academy of Medical Sciences elected in 2003 work in the four institutions mentioned, mid-career research productivity does not seem to be over-represented in those who receive the greatest funding and who are associated with the greatest supposed critical mass. ... McFarlane’s law states that ‘when conflicting theories co-exist, any point on which they all agree is the one most likely to be wrong.’ An apparently widespread agreement by policy makers that further concentration of clinical research would both improve research productivity and not damage quality in the NHS seems to breach this law. The dependence or non-dependence of productivity on so-called critical mass needs more sophisticated analysis than it has so far received."
Boyd R. McFarlane’s law, critical mass, and clinical research. Lancet. June 7, 2003
Submitted by Student
|
FOOTNOTES |
|---|
Received for publication Jan 25, 2002; Accepted Apr 17, 2003.
Reprint requests to (M.S.) Department of Pediatrics, Fukushima Medical University, School of Medicine, Hikarigaoka 1, Fukushima 960-1295, Japan. E-mail: toki422{at}guitar.ocn.ne.jp
|
REFERENCES |
|---|
|
TOPABSTRACTMETHODSRESULTSDISCUSSIONMcFARLANE'S INSIGHTREFERENCES |
|---|
- Curfs JHA, Meis JFGM, Hoogkamp-Korstanje JAA. A primer on cytokines: sources, receptors, effects, and inducers. Clin Microbiol Rev.1997; 10 :742 –780[Abstract]
- Hirano T, Kishimato T. Interleukin-6. In: Sporn MB, Roberts AB, eds. Handbook of Experimental Pharmacology: Peptide Growth Factors and Their Receptors. Heidelberg, Germany: Springer-Verlag; 1990:633–665
- Smith WB, Gamble JR, Vadas MA. The role of granulocyte-macrophage and granulocyte colony-stimulating factors in neutrophil transendothelial migration with interleukin-8. Exp Hematol.1994; 22 :329 –334[Web of Science][Medline]
- Goto K, Nakamura S, Goto F, Yoshinaga M. Generation of an interleukin-1-like lymphocyte-stimulating factor at inflammatory sites: correlation with the infiltration of polymorphonuclear leukocytes. Br J Exp Pathol.1984; 65 :521 –532[Web of Science][Medline]
- Mustafa MM, Ramilo O, Olsen KD, et al. Tumor necrosis factor in mediating experimental Haemophilus influenzaetypeB meningitis. J Clin Invest. 1989;84 :1253 –1259
- Utsunomiya I, Nagai S, Oh-ishi S. Sequential appearance of IL-1 and IL-6 activities in rat carrageenin-induced pleurisy. J Immunol.1991; 147 :1803 –1809[Abstract]
- Hosoya M, Honzumi K, Suzuki H. Detection of enterovirus by polymerase chain reaction and culture in cerebrospinal fluid of children with transient neurologic complications associated with acute febrile illness. J Infect Dis.1997; 175 :700 –703[Web of Science][Medline]
- Gallo P, Sivieri S, Rinaldi L, et al. Intrathecal synthesis of interleukin-10 (IL-10) in viral and inflammatory diseases of the central nervous system. J Neurol Sci.1994; 126 :49 –53[CrossRef][Web of Science][Medline]
- Paris MM, Hickey SM, Trujillo M, Ahmed A, Olsen K, McCracken GH Jr. The effect of interleukin-10 on meningeal inflammation in experimental bacterial meningitis. J Infect Dis.1997; 176 :1239 –1246[Web of Science][Medline]
- Ossege LM, Voss B, Wiethege T, Sindern E, Malin JP. Detection of transforming growth factor beta 1 mRNA in cerebrospinal fluid cells of patients with meningitis by nonradioactive in situ hybridization. J Neurol.1994; 242 :14 –19[CrossRef][Web of Science][Medline]
- Waage A, Halstensen A, Shalaby R, Brandzaeg P, Kierulf P, Espevik T. Local production of tumor necrosis factor-, interleukin 1, and interleukin 6 in meningococcal meningitis.
J Exp Med.1989; 170
:1859
–1867
[Abstract/Free Full Text] - Odio CM, Faingezicht I, Paris M, et al. The bacterial effects of early dexamethasone administration in infants and children with bacterial meningitis. N Engl J Med.1991; 324 :1525 –1531[Abstract]
- Dulkerian SJ, Kilpatrick L, Costarino AT Jr, et al. Cytokine elevations in infants with bacterial and aseptic meningitis. J Pediatr.1995; 126 :872 –876[CrossRef][Web of Science][Medline]
- Ramilo O, Mustafa MM, Poter J, et al. Detection of interleukin 1 beta but not tumor necrosis factor- in cerebrospinal fluid of children with aseptic meningitis.
Am J Dis Child.1990; 144
:349
–352
[Abstract/Free Full Text] - Ishiguro A, Suzuki Y, Inaba Y, et al. The production of IL-8 in cerebrospinal fluid in aseptic meningitis of children. Clin Exp Immunol.1997; 109 :426 –430[CrossRef][Web of Science][Medline]
- Ohga S, Aoki T, Okada K, et al. Cerebrospinal fluid concentrations of interleukin-1 ß, and tumor necrosis factor alpha, interferon gamma in bacterial meningitis.
Arch Dis Child.1994; 70
:123
–125
[Abstract/Free Full Text] - Ishiguro A, Suzuki Y, Inaba Y, Komiyama A, Koeffler HP, Shimbo T. Production of interleukin-10 in the cerebrospinal fluid in aseptic meningitis of children. Pediatr Res.1996; 40 :610 –614[Web of Science][Medline]
- Ossege LM, Sindern E, Voss B, Malin JP. Expression of tumor necrosis factor- and transforming growth factor-beta-1 in cerebrospinal fluid cells in meningitis.
J Neurol Sci.1996; 144
:1
–13[CrossRef][Web of Science][Medline]
- Sawyer MH, Holland D, Aintablian N, Connor JD, Keyser EF, Waecker NJ Jr. Diagnosis of enteroviral central nervous system infection by polymerase chain reaction during a large community outbreak. Pediatr Infect Dis J.1994; 13 :177 –182[Web of Science][Medline]
- Wildin S, Chonmaitree T. The importance of the virology laboratory in the diagnosis and management of viral meningitis.
Am J Dis Child.1987; 141
:454
–457
[Abstract/Free Full Text] - Täuber MG, Moser B. Cytokines and chemokines in meningeal inflammation: biology and clinical implications. Clin Infect Dis.1999 :28 :1 –11[Web of Science][Medline]
PEDIATRICS (ISSN 1098-4275). ©2003 by the American Academy of Pediatrics
CiteULike 
Connotea 
Del.icio.us 
Digg 
Facebook 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
|
|
 |
|
  Y.-C. Hwang, W. Chen, and M. V. Yates Use of fluorescence resonance energy transfer for rapid detection of enteroviral infection in vivo. Appl. Envir. Microbiol., May 1, 2006; 72(5): 3710 - 3715. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
