 |
|
 |
|
 |
 |
|
 |
 |
 |
 |
 |
 |
 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
PEDIATRICS Vol. 108 No. 4 October 2001, pp. 856-865
,,
,,,,,,, and
From the * Departments of Internal Medicine, Objective. Streptococcus
pneumoniae is one of the most clinically significant pathogens
with emerging antibiotic resistance. We performed a surveillance study
in isolated rural populations of healthy children to estimate the
prevalence of pneumococcal resistance and to contrast factors that
predict pneumococcal carriage with those that specifically predict
resistant pneumococcal carriage.
Methods. The study was conducted in 1998 in 2 rural
communities in Utah. Families were recruited directly for participation
through community canvassing. Surveillance nasopharyngeal cultures were obtained from children who were younger than 8 years. Antibiotic usage
and information on other potential risk factors were obtained from
questionnaires and local pharmacy records. Resistance was determined by
testing isolates for susceptibility to penicillin, cefaclor, trimethoprim-sulfamethoxazole, erythromycin,
ceftriaxone, and trovafloxacin. Selected resistant isolates were
characterized further by serotyping, pulsed field gel electrophoresis,
and Southern blot with DNA probes specific for the pneumococcal
lytA gene and for antibiotic resistance genes.
Results. In April 1998, surveillance nasopharyngeal
cultures were obtained from 368 children aged Conclusions. Young age and intrafamilial transmission were
important risk factors for carriage of both susceptible and resistant
S pneumoniae. In contrast, previous cephalosporin use
was linked specifically to resistant pneumococcal carriage, which
suggests that modifications in antibiotic usage patterns may have
salutary effects on antimicrobial resistance. These results extend
previous observations in large cities regarding the penetration of
multiple-drug-resistant clones of pneumococci into community
populations.
Family and
Preventive Medicine, and § Pathology, University of Utah, Salt Lake
City, Utah; Rockefeller University, New York, New York; and
¶ Department of Health and Medical Science, University of California
Berkeley, Berkeley, California.
ABSTRACT
Top
Abstract
Methods
Results
Discussion
Conclusion
References
8 years in community A
and 369 children in community B. The number of antibiotic courses per
child within 1 year before culture was higher in community B than A
(mean: 2.2 vs 1.7). Conversely, oral cephalosporins were more
frequently used in community A than B (community A: 22% received
cephalosporins within 4 months; community B: 12%). Colonization with
S pneumoniae was detected in 24% of children in
community A and 14% in community B; 36% of isolates from community A
and 28% of isolates from community B were resistant or intermediately
susceptible to at least 1 antibiotic tested. Reduced susceptibility was
most common to trimethoprim-sulfamethoxazole and cefaclor
(28% and 26%, respectively). Pneumococcal carriage (susceptible or
resistant) was independently associated with age <5 years
(odds ratio [OR]: 2.2), child care exposure (OR: 2.4), presence of a
sibling with a positive culture (OR: 3.3), and residence in community A
(OR: 1.7). Among carriers, age <2 years (OR: 2.6), use of
cephalosporins within the preceding 4 months (OR: 2.7), and having a
sibling colonized with resistant S pneumoniae (OR: 5.5)
were independent predictors of reduced susceptibility or resistance.
Each pair of resistant isolates from siblings was indistinguishable by
pulsed field gel electrophoresis and other molecular typing techniques.
Several pneumococcal isolates from these isolated rural areas had the
molecular characteristics of international clones of
multiple-drug-resistant pneumococci that have been associated with
worldwide spread.
Streptococcus pneumoniae is one of the most
clinically significant pathogens with emerging resistance to
antibiotics.1-5 Since 1990, penicillin-resistant clones
of pneumococci have spread rapidly throughout the United
States.6,7 In a large US multicenter study of respiratory
pathogens from the 1996 to 1997 winter season, the proportion of
clinical pneumococcal isolates with reduced susceptibility to
penicillin was 33.5%.8 Alterations in penicillin-binding
proteins that mediate penicillin resistance also confer reduced
susceptibility to other Previously reported epidemiologic studies identified young
age,13,14 previous To address these problems, we studied pneumococcal carriage in isolated
rural populations where children were recruited for participation
solely on the basis of community of residence, thus minimizing
potential selection biases. The major aims of this investigation were
to determine the prevalence of antibiotic-resistant pneumococci carried
by healthy children in rural Utah; to compare factors that predicted
overall pneumococcal carriage with those that predicted resistant
pneumococcal carriage; and to assess the feasibility of conducting a
community-based, ecologic study of antibiotic usage and resistance.
Antibiotic-resistant pneumococcal isolates also were compared with
international clones of multiply resistant S pneumoniae.
Study Population
Pharmacies located in 5 geographically isolated, small, rural
Utah communities were surveyed to determine the distribution of
pediatric antibiotic prescriptions issued during November and December
of 1997. The fraction of antibiotic prescriptions that belonged to the
cephalosporin class ranged from 10% to 39%. Two communities with
divergent antibiotic prescribing practices were selected for the
performance of the cross-sectional surveillance study and are referred
to here as A and B. Communities A and B were 170 miles apart and had
population sizes of 4473 and 8712, respectively. Each community housed
a small acute care hospital. Three primary care physicians practiced in
community A, and 8 practiced in community B.
A variety of recruitment techniques were used to enlist families
directly in each community to participate. These included solicitation
of support from community leaders, media coverage in local newspapers,
distribution of informational fliers, mailing of letters to parents of
children who attend public and private schools, and exchange of
information via social networks of parents.
Microbiologic Procedures
In April 1998, field teams consisting of trained health care
personnel obtained nasopharyngeal surveillance cultures from healthy
children in each community. To standardize technique, the field
personnel received specific training in the method for nasopharyngeal
culturing. A rayon-tipped swab (Mini-Tip Culturette; Becton-Dickinson Microbiology Systems, Cockeysville, MD) was inserted into the posterior nasopharynx, rotated gently, and removed. Equivalent training procedures were applied to the field teams in each community to ensure consistent culturing methods. The swabs then were placed immediately into the accompanying modified Stuart's transport media.
At the end of each collection day, the swabs were transported by
courier to a central laboratory (Associated and Regional University Pathologists Laboratories, Salt Lake City, UT) for processing. All
swabs were plated within 24 hours of collection. Each swab was
inoculated onto both a 5% Columbia sheep blood agar plate and a
selective gentamicin sheep blood agar plate (Remel Inc, Lenexa, KS). The plates were incubated at 37°C in 5% to 10%
CO2 and were examined at 16 to 24 hours and then
again at 48 hours for organisms typical of S pneumoniae.
Isolates were identified as S pneumoniae by colony
morphology, Data and Statistical Analysis
A questionnaire was administered to the parents or guardians of
participating children to collect demographic, antibiotic usage, and
potential exposure data. Child care was defined as regular attendance
in a grouped child care setting outside the home or the school.
Antibiotic histories were obtained from prescription records provided
by local pharmacies and physician offices. Antibiotics used
sequentially were considered distinct courses. Data were entered into
Microsoft Excel 97 and analyzed using SPSS
8.0 for Windows NT (SPSS, Inc, Chicago, IL) and Stata 5.0. Fisher's
exact test (College Station, TX) and the Pulsed Field Gel Electrophoresis
Chromosomal DNA fragments, generated by SmaI
digestion, were prepared and analyzed as described
previously.32 A CHEF-DRII apparatus (Bio-Rad,
Hercules, CA) was used for running the gels. Running conditions were 23 hours at 11.3°C at a voltage set of 200 V ramped with initial forward
time of 5 seconds and final forward time of 35 seconds. Gels were
stained with ethidium bromide and photographed.
Hybridization With DNA Probes
Gels to be hybridized were transferred to nylon membranes with
the vacuum gene system (Amersham Pharmacia Biotech,
Piscataway, NJ). The resulting membranes were probed using the ECL
system (Amersham Pharmacia Biotech) according to the
manufacturer's recommendations. The molecular weight of the
hybridization signals and the corresponding SmaI fragments
were determined by comparison with a molecular weight ladder.
Probes
DNA probes for ermB and mefE genes were
obtained through polymerase chain reaction using as templates S
pneumoniae strains 02J 1095 (for ermB) and 02J 1175 (for mefE) and primers GAAAARGTACTAACCAAATA and
AGTAAYGGTACTTAAATTGTTTAC (for ermB) and
AGTATCATTAATCACTAGTGC and CGTAATAGATGCAATCACAGC (for mefE),
generated on the basis of sequences published by Sutcliffe et
al.33 Primers used for generating the tetM
probe were tetmd-TGGAATTGATTTATCAACGG and tetmr-TTCCAACCATACAATCCTTG
designed to amplify a 1080-bp region internal to the tetM
gene.34 The DNA probe for the lytA gene
encompassed an 890 nucleotide internal fragment of
lytA.35 Polymerase chain reaction was performed
with denaturation at 94°C for 60 seconds, annealing at 50°C for 30 seconds, and followed by extension at 72°C for 1 minute for 30 cycles. Purification and labeling of the probes were as described
previously.36,37
Description of Study Populations of Communities A and B
Surveillance cultures were obtained from 368 children (177 families) in community A and 369 children (212 families) in community B. The sampling fraction for children TABLE 1
-lactam antibiotics.4,9,10
Furthermore, -lactam-resistant clones often have high rates of
resistance to other antibiotics, such as macrolides,
trimethoprim-sulfamethoxazole, and tetracycline.6,11,12
-lactam antibiotic
treatment,14-17 and attendance at child care
centers17-23 as particularly important risk factors for
acquisition and carriage of resistant S pneumoniae. Many of
these investigations were centered in urban areas where the resistant
clones were first identified and relied on isolates collected from
clinically ill patients. Typically, individuals with infections
attributable to resistant S pneumoniae were compared with
patients with infections due to susceptible S pneumoniae but
not to uninfected members of the source population. Studies that have
used nasopharyngeal swabs to identify colonized individuals usually
have focused on special populations, such as child care or outpatient
clinic attendees.11,1417-30
METHODS
Top
Abstract
Methods
Results
Discussion
Conclusion
References
hemolysis, and bile solubility and susceptibility to
Optochin. Antimicrobial susceptibility testing was performed using the
E-test (AB Biodisk, Solna, Sweden). A 0.5 McFarland standard of freshly
subcultured organisms was inoculated to a 150-mm Mueller Hinton plate
with 5% sheep blood. The E-test strips were applied, and the agar
supplemented plates were incubated in 5% to 10%
CO2 at 37°C for 20 to 24 hours. The minimum
inhibitory concentration (MIC) was read at the point where the
elliptical zone of inhibition intersected the strip. The following
agents were tested: penicillin G, cefaclor, ceftriaxone,
erythromycin, trimethoprim-sulfamethoxazole, and trovafloxacin.
Categorical interpretations for the MIC values were assigned by using
the 1998 National Committee for Clinical Laboratory Standards break points.31 Resistance was defined for each of the 6 agents tested as follows: penicillin 0.12 to 1.0 µg/mL (intermediate), 
2.0
µg/mL (resistant); ceftriaxone 1.0 µg/mL (intermediate), 2.0
µg/mL (resistant); erythromycin 0.5 µg/mL (intermediate), 1.0
µg/mL (resistant); 1.0 (trimethoprim)/19.0 (sulfamethoxazole) to
2.0/38.0 µg/mL (intermediate), 4.0/76.0 µg/mL (resistant); trovafloxacin 2.0 µg/mL (intermediate), 4.0 µg/mL (resistant); cefaclor 2.0 µg/mL (intermediate), 4.0 µg/mL
(resistant). Susceptibility to chloramphenicol and tetracycline of
selected isolates was determined by disk diffusion assay following
standard National Committee for Clinical Laboratory Standards
procedures.
2
test were used for statistical comparisons of categorical data when
appropriate. Primary analyses of risk factors were performed in 2 ways.
First, predictors of S pneumoniae carriage were examined, using the entire study population as the denominator. Second, factors
associated with resistance were assessed using as the denominator
patients who were carriers. Odds ratios (OR) and Mantel-Hantzel adjusted OR were calculated for individual variables stratified by
community. Multivariable models were constructed using logistic regression. Variables were selected for inclusion in the final model on
the basis of the likelihood ratio test (P < .05) or a change in effect estimate of >15% for other independent risk factors. Community of residence also was included in each multivariable model.
Interactions between variables were assessed using appropriate multiplicative terms.
RESULTS
Top
Abstract
Methods
Results
Discussion
Conclusion
References
8 years in community A was 68%
(368 of 542) and in community B was 59% (369 of 630). The age and
gender distribution of enrolled children was similar in the 2 communities (Table 1). The mean age of
the children was 5.0 and 5.1 years in communities A and B,
respectively. Family sizes tended to be somewhat larger in community A
than B; the mean number of children 8 years per family was 2.6 and
2.3, respectively (P < .001 by the Kruskal-Wallis
test). Child care exposure was infrequent in both communities, present
overall in only 5%.
Characteristics of Patients From Each Community
The mean number of antibiotic courses per child during the previous 12 months was similar in both communities: 2.1 in community A and 2.2 in community B. Usage of cephalosporins was significantly greater in community A (P < .001), whereas usage of penicillin (P < .001), macrolides (P = .006), and sulfonamides (P < .001) was higher in community B (P < .001). The selection of individual cephalosporins also differed substantially between communities. The top 3 cephalosporins in community A were (in order) cefixime, loracarbef, and ceftibuten; in community B, the top 3 cephalosporins were loracarbef, ceftibuten, and cefixime. Cefixime accounted for 15% of antibiotic prescriptions in study children in community A but only 2% of prescriptions in community B (P < .001). The frequency of different types of infections was similar in the 2 communities. Overall, 70% of the study children in community A and 73% of the study children in community B received at least 1 course of antibiotics during the preceding 12 months. The comparable percentages for receipt of antibiotics during the preceding 4 months were 49% and 55%.
Results of Surveillance Cultures
Colonization with S pneumoniae was detected in 88 (24%) of 368 children in community A and 50 (14%) of 369 children in
community B (P < .001; Table
2). Thirty-four percent of isolates (30 of 88) from community A and 24% of isolates (12 of 50) from community
B had at least intermediate resistance to 1 or more antibiotics tested.
Twenty-eight percent of isolates exhibited reduced susceptibility to
trimethoprim-sulfamethoxazole, 22% to cefaclor, 25%
to penicillin, 14% to erythromycin, 2% to ceftriaxone, and 0% to
trovafloxacin. Three isolates (2%) had MIC to penicillin of 2.0
mg/dL. Thirty-one (74%) of the 42 resistant or intermediate-resistant isolates exhibited reduced susceptibility to more than 1 drug class.
The single most common resistant phenotype (19 isolates) was reduced
susceptibility to cefaclor, penicillin, erythromycin, and
trimethoprim-sulfamethoxazole (Table 3).
|
|
Risk Factors for Colonization With S pneumoniae
S pneumoniae colonization in each community was
associated with age <5 years, child care exposure, number of children
in the family 8 years, and presence of a sibling with a positive
culture (Table 4). In the multivariable
logistic model, community, age, child care exposure, and presence of
sibling with positive culture remained independent risk factors for
carriage (Table 5). The presence of a
sibling with a positive culture and family size were highly collinear;
that is, the likelihood of having a sibling with a positive culture was
higher in larger families. When the exposure of having a sibling with a
positive culture was included in the logistic model, family size was no
longer a statistically significant predictor of carriage. Antibiotic
treatment, whether measured with respect to total number of courses or
classified by individual class, was not an independent risk factor for
pneumococcal carriage.
|
|
Risk Factors for Colonization With Resistant S pneumoniae
Use of cephalosporins within the preceding 4 months, age <2 years, and having a sibling colonized with resistant S pneumoniae were significantly associated with carriage of resistant S pneumoniae (Table 6). The multivariable model confirmed that each of these was an independent risk factor (Table 7). The effect of cefixime was stronger than for other cephalosporins (adjusted OR for cefixime: 3.9; OR for all other cephalosporins combined: 2.5).
|
|
Analysis of Resistant Isolates From Sibling Pairs
Eight pairs of siblings were colonized with resistant S
pneumoniae. Isolates from each pair were identical with respect to susceptibility interpretive class and within 1 dilution difference of
each other with respect to the MIC of each antibiotic tested. These 16 isolates, representing 35% of the resistant pneumococci detected, were
characterized further to ascertain their clonal relationships. Each
pair of sibling isolates was indistinguishable on the basis of pulsed
field gel electrophoresis (PFGE) analysis, serotype, and hybridization
with DNA probes specific for the determinants of resistance to
erythromycin (mef), tetracycline (tetm), and chloramphenicol (cat) and the epidemiologic marker
lytA (Fig 1). Four of the
multiresistant serotype 23F isolates
A249, A251, A363, and
A364showed PFGE patterns, lytA hybridization profiles, and antibiotype characteristics indicating that they were subtype variants
of the pandemic Spanish/USA clone.38An additional pair of serogroup 23 isolatesA314, A315with low-level penicillin resistance were members of an S pneumoniae cluster ("USA
cluster 5"), which is widely spread in the Midwestern and Western
states of the United States.12 Four serogroup 9 isolatesB295, B296, B356, and B355were identified as subtype
variants of another clone widely spread in the United
States,12 Latin America,39 and Europe.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Methods
Results
Discussion
Conclusion
References
|
|---|
We describe a population-based study to compare antibiotic usage
among rural communities and to assess risk factors for pneumococcal carriage and resistance. The major findings were that 1) an elevated rate of overall pneumococcal carriage and resistant pneumococcal carriage was found in the community with high cephalosporin use; 2) in
individual childrenafter adjusting for age, community residence, and
sibling exposurecephalosporin exposure was independently associated
with carriage with resistant S pneumoniae; and 3)
transmission of S pneumoniae within households was suggested
by the risk factor analysis and proved by the molecular analysis of
isolates from pairs of siblings. Taken together, these results confirm
and extend previous observations by demonstrating the penetration of
pneumococcal resistance into community populations of children who live
in rural settings and by documenting the contribution of intrafamilial transmission to the dissemination of the organisms. Antibiotic selection pressure remains a driving force of pneumococcal resistance even in this rural setting.19,2140-46
The observed variation in distribution of antibiotic use between
communities is reminiscent of observations obtained in studies conducted more than 20 years ago that described significant divergences in medical practices across different communities in New
England.47 In both communities, the overall frequency of
antibiotic exposure was high, such that 72% of children 8 years and
89% of children <2 years were recipients of at least 1 course of
antibiotics during the 12-month period before culturing. In addition,
51% of children who did not receive antibiotics during the 12-month
period had siblings who received antibiotics.
Our primary risk factor analysis was performed in 2 parts. First, we examined factors that predicted carriage among the overall population; second, we identified factors that predicted resistance among carriers. Exposure to a colonized sibling was associated with overall carriage, and exposure to a sibling colonized with resistant S pneumoniae was associated with resistant carriage. The role of intrafamilial transmission was confirmed by molecular analysis in that each pair of isolates from siblings had indistinguishable chromosomal macrorestriction profiles by PFGE analysis and also exhibited identical patterns of hybridization bands with a lytA DNA probe that was recently introduced as a molecular epidemiologic marker.35 Thus, state-of-the-art molecular techniques reaffirmed results of studies conducted 25 years ago that identified frequent intrahousehold transmission of S pneumoniae, typically coincident with the onset of cold symptoms in preschool-aged children.48 Familial transmission of resistant clones occurred in both antibiotic-exposed and -nonexposed children. Of the 18 children who carried resistant pneumococci and had not received antibiotics in the previous 4 months, 8 (44%) had a sibling with resistant pneumococci.
Child care centers, which were infrequently used in these populations, did not play a significant role in contributing to dissemination of resistant pneumococci in these rural areas, in contrast to many other epidemiologic investigations of resistant pneumococci. Conversely, other types of gatherings that involve close contact between children from different households may be more common in rural areas, particularly in highly cohesive, primarily Mormon communities. These 2 study communities differed significantly with respect to the proportion of residents who were members of the Church of Jesus Christ of Latter-day Saints. However, insufficient data were collected to address transmission of pneumococci in church or other social settings.
Only the cephalosporin class of antibiotics predicted resistance in this study. When children who were colonized with resistant pneumococci were compared with all other children, not just those who were colonized with susceptible pneumococci, cephalosporin exposure still significantly correlated with resistance, but the size of the effect was smaller. Children who carried susceptible pneumococci had a lower frequency of cephalosporin exposure than noncarriers. Thus, the dual effect of antibiotics to reduce carriage with susceptible organisms and increase colonization with resistant organisms needs to be considered when performing risk factor analyses of antibiotic resistance.
-Lactam use has been identified as a risk factor in other studies of
pneumococcal resistance, most of which relied on analyses of S
pneumoniae isolated from clinically directed cultures or made
comparisons solely between individuals with susceptible and resistant
pneumococci.28 In studies in which the relative risk of
cephalosporins was compared with that for penicillins, differences were
not found.15,19,49,50 A possible explanation for the
higher risk associated with cephalosporins in this study is that the
most heavily used cephalosporin was cefixime, an agent
with relatively poor activity against Gram-positive organisms compared
with other cephalosporins. Consistent with this hypothesis, in a
secondary analysis of the data, the relative risk for
cefixime was found to be higher than for other
cephalosporins.
Recently, pneumococcal carriage was examined in children who were randomized to cefixime or amoxicillin/clavulanic acid for treatment of otitis media. Striking differences in the results of nasopharyngeal cultures were that susceptible S pneumoniae were eradicated much more effectively by amoxicillin/clavulanic acid and that acquisition of resistant S pneumoniae was 3-fold more frequent on cefixime: 19 of 21 S pneumoniae acquired during therapy in cefixime-treated patients were penicillin resistant.51 The results of the study presented here provide field data to suggest that cephalosporins with comparatively poor Gram-positive activity may have distinct effects on S pneumoniae resistance at either an individual level or a population level.
The molecular typing results suggest that importation of resistant pneumococcal clones is one mechanism by which antibiotic resistance genes appeared in the pneumococci colonizing children in these communities. Ten of the 16 isolates (5 pairs of isolates from siblings) examined by molecular typing techniques were identified as representatives of pneumococcal clones frequently recovered among disease-causing isolates in the United States. Four isolates represented subtype variants of the pandemic 23F Spanish/USA clone,38 2 were members of an S pneumoniae cluster that is widely spread in the Midwestern and Western states of the United States,12 and 4 were subtype variants of a serotype 9 clone widely spread in the United States,12 Latin America,39 and Europe.52
Limitations of this study were that the inclusion of 2 communities for surveillance cultures precluded an ecologic-level analysis and that clinical data were collected retrospectively. The lack of serial culture results also constrained our ability to analyze temporal relationships between antibiotic exposure and acquisition of resistant pneumococci.
| |
CONCLUSION |
|---|
|
Top
Abstract
Methods
Results
Discussion
Conclusion
References
|
|---|
This study provides support to efforts to lower pneumococcal resistance through improved antibiotic use. One approach is to promote a reduction in overall antibiotic usage for nonsupported indications such as viral upper respiratory tract infections.53-57 Additional studies are needed to assess the relative merit of these various strategies to bring the problem of antimicrobial resistance under better control.58
| |
ACKNOWLEDGMENTS |
|---|
This study was supported in part by Pfizer Inc, Abbott Laboratories Inc, and the National Institutes of Health (RO1 AT 37275).
| |
FOOTNOTES |
|---|
Received for publication Oct 24, 2000; accepted Feb 26, 2001.
Reprint requests to (M.S.) University of Utah Department of Internal Medicine, 50 North Medical Dr, 4B319 SOM, Salt Lake City, UT 84132. E-mail: matthew.samore{at}hsc.utah.edu
| |
ABBREVIATIONS |
|---|
MIC, minimum inhibitory concentration; PFGE, pulsed field gel electrophoresis; OR, odds ratio.
| |
REFERENCES |
|---|
|
Top
Abstract
Methods
Results
Discussion
Conclusion
References
|
|---|
Bangui, Central African Republic.
MMWR Morb Mortal Wkly Rep.
1997;
46:62-64 [Medline]This article has been cited by other articles:
 |
|
 |
|
  T. P. Lodise, M. Kinzig-Schippers, G. L. Drusano, U. Loos, F. Vogel, J. Bulitta, M. Hinder, and F. Sorgel Use of Population Pharmacokinetic Modeling and Monte Carlo Simulation To Describe the Pharmacodynamic Profile of Cefditoren in Plasma and Epithelial Lining Fluid Antimicrob. Agents Chemother., June 1, 2008; 52(6): 1945 - 1951. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. H. Samore, M. Lipsitch, S. C. Alder, B. Haddadin, G. Stoddard, J. Williamson, K. Sebastian, K. Carroll, O. Ergonul, Y. Carmeli, et al. Mechanisms by Which Antibiotics Promote Dissemination of Resistant Pneumococci in Human Populations Am. J. Epidemiol., January 15, 2006; 163(2): 160 - 170. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. H. Samore, K. Bateman, S. C. Alder, E. Hannah, S. Donnelly, G. J. Stoddard, B. Haddadin, M. A. Rubin, J. Williamson, B. Stults, et al. Clinical Decision Support and Appropriateness of Antimicrobial Prescribing: A Randomized Trial JAMA, November 9, 2005; 294(18): 2305 - 2314. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. S. Glasgow, P. C. Young, J. Wallin, C. Kwok, G. Stoddard, S. Firth, M. Samore, and C. L. Byington Association of Intrapartum Antibiotic Exposure and Late-Onset Serious Bacterial Infections in Infants Pediatrics, September 1, 2005; 116(3): 696 - 702. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. T. Halpern, J. K. Schmier, L. M. Snyder, C. Asche, P. W. Sarocco, B. Lavin, R. Nieman, and L. A. Mandell Meta-analysis of bacterial resistance to macrolides J. Antimicrob. Chemother., May 1, 2005; 55(5): 748 - 757. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. S. Huang, J. A. Finkelstein, S. L. Rifas-Shiman, K. Kleinman, and R. Platt Community-Level Predictors of Pneumococcal Carriage and Resistance in Young Children Am. J. Epidemiol., April 1, 2004; 159(7): 645 - 654. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. K. Shutt, M. Samore, and K. C. Carroll Comparison of the Denka Seiken Slide Agglutination Method to the Quellung Test for Serogrouping of Streptococcus pneumoniae Isolates J. Clin. Microbiol., March 1, 2004; 42(3): 1274 - 1276. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. E. Low, M. E. Pichichero, and U. B. Schaad Optimizing Antibacterial Therapy for Community-Acquired Respiratory Tract Infections in Children in an Era of Bacterial Resistance Clinical Pediatrics, March 1, 2004; 43(2): 135 - 151. [Abstract] [PDF]
|
|
|
|
|
|
J. A. Finkelstein, S. S. Huang, J. Daniel, S. L. Rifas-Shiman, K. Kleinman, D. Goldmann, S. I. Pelton, A. DeMaria, and R. Platt Antibiotic-Resistant Streptococcus pneumoniae in the Heptavalent Pneumococcal Conjugate Vaccine Era: Predictors of Carriage in a Multicommunity Sample Pediatrics, October 1, 2003; 112(4): 862 - 869. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Bauchner and R. E. Besser Promoting the Appropriate Use of Oral Antibiotics: There Is Some Very Good News Pediatrics, March 1, 2003; 111(3): 668 - 670. [Full Text] [PDF]
|
|
|
|
 |
|
 Risk Factors for Streptococcus pneumoniae in Rural Kids Journal Watch Infectious Diseases, November 16, 2001; 2001(1116): 8 - 8. [Full Text]
|
|
| |||||||||||||||||||||||||||
phage low molecular weight standards (L.m.w.) are included
as molecular size markers. B, Southern hybridization with a DNA probe
specific for the lytA gene was performed on the
SmaI hydrolysates shown in