PEDIATRICS Vol. 108 No. 4 October 2001, pp. 856-865

High Rates of Multiple Antibiotic Resistance in Streptococcus pneumoniae From Healthy Children Living in Isolated Rural Communities: Association With Cephalosporin Use and Intrafamilial Transmission

Matthew H. Samore, MD^*, Michael K. Magill, MD, Stephen C. Alder, MS, Elena Severina, PhD, Leonie Morrison-de Boer, MD, J. Lynn Lyon, MD, MPH, Karen Carroll, MD^§, Joyce Leary, BS^¶, Mary Bishop Stone, MBA, David Bradford, PhD, MPH, James Reading, PhD, MPH, Alexander Tomasz, PhD, and Merle A. Sande, MD^*

From the ^* Departments of Internal Medicine,  Family and Preventive Medicine, and ^§ Pathology, University of Utah, Salt Lake City, Utah;  Rockefeller University, New York, New York; and ^¶ Department of Health and Medical Science, University of California Berkeley, Berkeley, California.

	ABSTRACT

Top Abstract Methods Results Discussion Conclusion References

Objective.  Streptococcus pneumoniae is one of the most clinically significant pathogens with emerging antibiotic resistance. We performed a surveillance study in isolated rural populations of healthy children to estimate the prevalence of pneumococcal resistance and to contrast factors that predict pneumococcal carriage with those that specifically predict resistant pneumococcal carriage.

Methods.  The study was conducted in 1998 in 2 rural communities in Utah. Families were recruited directly for participation through community canvassing. Surveillance nasopharyngeal cultures were obtained from children who were younger than 8 years. Antibiotic usage and information on other potential risk factors were obtained from questionnaires and local pharmacy records. Resistance was determined by testing isolates for susceptibility to penicillin, cefaclor, trimethoprim-sulfamethoxazole, erythromycin, ceftriaxone, and trovafloxacin. Selected resistant isolates were characterized further by serotyping, pulsed field gel electrophoresis, and Southern blot with DNA probes specific for the pneumococcal lytA gene and for antibiotic resistance genes.

Results.  In April 1998, surveillance nasopharyngeal cultures were obtained from 368 children aged 8 years in community A and 369 children in community B. The number of antibiotic courses per child within 1 year before culture was higher in community B than A (mean: 2.2 vs 1.7). Conversely, oral cephalosporins were more frequently used in community A than B (community A: 22% received cephalosporins within 4 months; community B: 12%). Colonization with S pneumoniae was detected in 24% of children in community A and 14% in community B; 36% of isolates from community A and 28% of isolates from community B were resistant or intermediately susceptible to at least 1 antibiotic tested. Reduced susceptibility was most common to trimethoprim-sulfamethoxazole and cefaclor (28% and 26%, respectively). Pneumococcal carriage (susceptible or resistant) was independently associated with age <5 years (odds ratio [OR]: 2.2), child care exposure (OR: 2.4), presence of a sibling with a positive culture (OR: 3.3), and residence in community A (OR: 1.7). Among carriers, age <2 years (OR: 2.6), use of cephalosporins within the preceding 4 months (OR: 2.7), and having a sibling colonized with resistant S pneumoniae (OR: 5.5) were independent predictors of reduced susceptibility or resistance. Each pair of resistant isolates from siblings was indistinguishable by pulsed field gel electrophoresis and other molecular typing techniques. Several pneumococcal isolates from these isolated rural areas had the molecular characteristics of international clones of multiple-drug-resistant pneumococci that have been associated with worldwide spread.

Conclusions.  Young age and intrafamilial transmission were important risk factors for carriage of both susceptible and resistant S pneumoniae. In contrast, previous cephalosporin use was linked specifically to resistant pneumococcal carriage, which suggests that modifications in antibiotic usage patterns may have salutary effects on antimicrobial resistance. These results extend previous observations in large cities regarding the penetration of multiple-drug-resistant clones of pneumococci into community populations.  Key words:  Streptococcus pneumoniae, antibiotic resistance, cephalosporins, familial transmission.

Streptococcus pneumoniae is one of the most clinically significant pathogens with emerging resistance to antibiotics.^1-5 Since 1990, penicillin-resistant clones of pneumococci have spread rapidly throughout the United States.^6,7 In a large US multicenter study of respiratory pathogens from the 1996 to 1997 winter season, the proportion of clinical pneumococcal isolates with reduced susceptibility to penicillin was 33.5%.⁸ Alterations in penicillin-binding proteins that mediate penicillin resistance also confer reduced susceptibility to other -lactam antibiotics.^4,9,10 Furthermore, -lactam-resistant clones often have high rates of resistance to other antibiotics, such as macrolides, trimethoprim-sulfamethoxazole, and tetracycline.^6,11,12

Previously reported epidemiologic studies identified young age,^13,14 previous -lactam antibiotic treatment,^14-17 and attendance at child care centers^17-23 as particularly important risk factors for acquisition and carriage of resistant S pneumoniae. Many of these investigations were centered in urban areas where the resistant clones were first identified and relied on isolates collected from clinically ill patients. Typically, individuals with infections attributable to resistant S pneumoniae were compared with patients with infections due to susceptible S pneumoniae but not to uninfected members of the source population. Studies that have used nasopharyngeal swabs to identify colonized individuals usually have focused on special populations, such as child care or outpatient clinic attendees.^11,1417-30

To address these problems, we studied pneumococcal carriage in isolated rural populations where children were recruited for participation solely on the basis of community of residence, thus minimizing potential selection biases. The major aims of this investigation were to determine the prevalence of antibiotic-resistant pneumococci carried by healthy children in rural Utah; to compare factors that predicted overall pneumococcal carriage with those that predicted resistant pneumococcal carriage; and to assess the feasibility of conducting a community-based, ecologic study of antibiotic usage and resistance. Antibiotic-resistant pneumococcal isolates also were compared with international clones of multiply resistant S pneumoniae.

	METHODS

Top Abstract Methods Results Discussion Conclusion References

Study Population

Pharmacies located in 5 geographically isolated, small, rural Utah communities were surveyed to determine the distribution of pediatric antibiotic prescriptions issued during November and December of 1997. The fraction of antibiotic prescriptions that belonged to the cephalosporin class ranged from 10% to 39%. Two communities with divergent antibiotic prescribing practices were selected for the performance of the cross-sectional surveillance study and are referred to here as A and B. Communities A and B were 170 miles apart and had population sizes of 4473 and 8712, respectively. Each community housed a small acute care hospital. Three primary care physicians practiced in community A, and 8 practiced in community B.

A variety of recruitment techniques were used to enlist families directly in each community to participate. These included solicitation of support from community leaders, media coverage in local newspapers, distribution of informational fliers, mailing of letters to parents of children who attend public and private schools, and exchange of information via social networks of parents.

Microbiologic Procedures

In April 1998, field teams consisting of trained health care personnel obtained nasopharyngeal surveillance cultures from healthy children in each community. To standardize technique, the field personnel received specific training in the method for nasopharyngeal culturing. A rayon-tipped swab (Mini-Tip Culturette; Becton-Dickinson Microbiology Systems, Cockeysville, MD) was inserted into the posterior nasopharynx, rotated gently, and removed. Equivalent training procedures were applied to the field teams in each community to ensure consistent culturing methods. The swabs then were placed immediately into the accompanying modified Stuart's transport media. At the end of each collection day, the swabs were transported by courier to a central laboratory (Associated and Regional University Pathologists Laboratories, Salt Lake City, UT) for processing. All swabs were plated within 24 hours of collection. Each swab was inoculated onto both a 5% Columbia sheep blood agar plate and a selective gentamicin sheep blood agar plate (Remel Inc, Lenexa, KS). The plates were incubated at 37°C in 5% to 10% CO₂ and were examined at 16 to 24 hours and then again at 48 hours for organisms typical of S pneumoniae. Isolates were identified as S pneumoniae by colony morphology,  hemolysis, and bile solubility and susceptibility to Optochin. Antimicrobial susceptibility testing was performed using the E-test (AB Biodisk, Solna, Sweden). A 0.5 McFarland standard of freshly subcultured organisms was inoculated to a 150-mm Mueller Hinton plate with 5% sheep blood. The E-test strips were applied, and the agar supplemented plates were incubated in 5% to 10% CO₂ at 37°C for 20 to 24 hours. The minimum inhibitory concentration (MIC) was read at the point where the elliptical zone of inhibition intersected the strip. The following agents were tested: penicillin G, cefaclor, ceftriaxone, erythromycin, trimethoprim-sulfamethoxazole, and trovafloxacin. Categorical interpretations for the MIC values were assigned by using the 1998 National Committee for Clinical Laboratory Standards break points.³¹ Resistance was defined for each of the 6 agents tested as follows: penicillin 0.12 to 1.0 µg/mL (intermediate), 2.0 µg/mL (resistant); ceftriaxone 1.0 µg/mL (intermediate), 2.0 µg/mL (resistant); erythromycin 0.5 µg/mL (intermediate), 1.0 µg/mL (resistant); 1.0 (trimethoprim)/19.0 (sulfamethoxazole) to 2.0/38.0 µg/mL (intermediate), 4.0/76.0 µg/mL (resistant); trovafloxacin 2.0 µg/mL (intermediate), 4.0 µg/mL (resistant); cefaclor 2.0 µg/mL (intermediate), 4.0 µg/mL (resistant). Susceptibility to chloramphenicol and tetracycline of selected isolates was determined by disk diffusion assay following standard National Committee for Clinical Laboratory Standards procedures.

Data and Statistical Analysis

A questionnaire was administered to the parents or guardians of participating children to collect demographic, antibiotic usage, and potential exposure data. Child care was defined as regular attendance in a grouped child care setting outside the home or the school. Antibiotic histories were obtained from prescription records provided by local pharmacies and physician offices. Antibiotics used sequentially were considered distinct courses. Data were entered into Microsoft Excel 97 and analyzed using SPSS 8.0 for Windows NT (SPSS, Inc, Chicago, IL) and Stata 5.0. Fisher's exact test (College Station, TX) and the ² test were used for statistical comparisons of categorical data when appropriate. Primary analyses of risk factors were performed in 2 ways. First, predictors of S pneumoniae carriage were examined, using the entire study population as the denominator. Second, factors associated with resistance were assessed using as the denominator patients who were carriers. Odds ratios (OR) and Mantel-Hantzel adjusted OR were calculated for individual variables stratified by community. Multivariable models were constructed using logistic regression. Variables were selected for inclusion in the final model on the basis of the likelihood ratio test (P < .05) or a change in effect estimate of >15% for other independent risk factors. Community of residence also was included in each multivariable model. Interactions between variables were assessed using appropriate multiplicative terms.

Pulsed Field Gel Electrophoresis

Chromosomal DNA fragments, generated by SmaI digestion, were prepared and analyzed as described previously.³² A CHEF-DRII apparatus (Bio-Rad, Hercules, CA) was used for running the gels. Running conditions were 23 hours at 11.3°C at a voltage set of 200 V ramped with initial forward time of 5 seconds and final forward time of 35 seconds. Gels were stained with ethidium bromide and photographed.

Hybridization With DNA Probes

Gels to be hybridized were transferred to nylon membranes with the vacuum gene system (Amersham Pharmacia Biotech, Piscataway, NJ). The resulting membranes were probed using the ECL system (Amersham Pharmacia Biotech) according to the manufacturer's recommendations. The molecular weight of the hybridization signals and the corresponding SmaI fragments were determined by comparison with a molecular weight ladder.

Probes

DNA probes for ermB and mefE genes were obtained through polymerase chain reaction using as templates S pneumoniae strains 02J 1095 (for ermB) and 02J 1175 (for mefE) and primers GAAAARGTACTAACCAAATA and AGTAAYGGTACTTAAATTGTTTAC (for ermB) and AGTATCATTAATCACTAGTGC and CGTAATAGATGCAATCACAGC (for mefE), generated on the basis of sequences published by Sutcliffe et al.³³ Primers used for generating the tetM probe were tetmd-TGGAATTGATTTATCAACGG and tetmr-TTCCAACCATACAATCCTTG designed to amplify a 1080-bp region internal to the tetM gene.³⁴ The DNA probe for the lytA gene encompassed an 890 nucleotide internal fragment of lytA.³⁵ Polymerase chain reaction was performed with denaturation at 94°C for 60 seconds, annealing at 50°C for 30 seconds, and followed by extension at 72°C for 1 minute for 30 cycles. Purification and labeling of the probes were as described previously.^36,37

	RESULTS

Top Abstract Methods Results Discussion Conclusion References

Description of Study Populations of Communities A and B

Surveillance cultures were obtained from 368 children (177 families) in community A and 369 children (212 families) in community B. The sampling fraction for children 8 years in community A was 68% (368 of 542) and in community B was 59% (369 of 630). The age and gender distribution of enrolled children was similar in the 2 communities (Table 1). The mean age of the children was 5.0 and 5.1 years in communities A and B, respectively. Family sizes tended to be somewhat larger in community A than B; the mean number of children 8 years per family was 2.6 and 2.3, respectively (P < .001 by the Kruskal-Wallis test). Child care exposure was infrequent in both communities, present overall in only 5%.

The mean number of antibiotic courses per child during the previous 12 months was similar in both communities: 2.1 in community A and 2.2 in community B. Usage of cephalosporins was significantly greater in community A (P < .001), whereas usage of penicillin (P < .001), macrolides (P = .006), and sulfonamides (P < .001) was higher in community B (P < .001). The selection of individual cephalosporins also differed substantially between communities. The top 3 cephalosporins in community A were (in order) cefixime, loracarbef, and ceftibuten; in community B, the top 3 cephalosporins were loracarbef, ceftibuten, and cefixime. Cefixime accounted for 15% of antibiotic prescriptions in study children in community A but only 2% of prescriptions in community B (P < .001). The frequency of different types of infections was similar in the 2 communities. Overall, 70% of the study children in community A and 73% of the study children in community B received at least 1 course of antibiotics during the preceding 12 months. The comparable percentages for receipt of antibiotics during the preceding 4 months were 49% and 55%.

Results of Surveillance Cultures

Colonization with S pneumoniae was detected in 88 (24%) of 368 children in community A and 50 (14%) of 369 children in community B (P < .001; Table 2). Thirty-four percent of isolates (30 of 88) from community A and 24% of isolates (12 of 50) from community B had at least intermediate resistance to 1 or more antibiotics tested. Twenty-eight percent of isolates exhibited reduced susceptibility to trimethoprim-sulfamethoxazole, 22% to cefaclor, 25% to penicillin, 14% to erythromycin, 2% to ceftriaxone, and 0% to trovafloxacin. Three isolates (2%) had MIC to penicillin of 2.0 mg/dL. Thirty-one (74%) of the 42 resistant or intermediate-resistant isolates exhibited reduced susceptibility to more than 1 drug class. The single most common resistant phenotype (19 isolates) was reduced susceptibility to cefaclor, penicillin, erythromycin, and trimethoprim-sulfamethoxazole (Table 3).

Risk Factors for Colonization With S pneumoniae

S pneumoniae colonization in each community was associated with age <5 years, child care exposure, number of children in the family 8 years, and presence of a sibling with a positive culture (Table 4). In the multivariable logistic model, community, age, child care exposure, and presence of sibling with positive culture remained independent risk factors for carriage (Table 5). The presence of a sibling with a positive culture and family size were highly collinear; that is, the likelihood of having a sibling with a positive culture was higher in larger families. When the exposure of having a sibling with a positive culture was included in the logistic model, family size was no longer a statistically significant predictor of carriage. Antibiotic treatment, whether measured with respect to total number of courses or classified by individual class, was not an independent risk factor for pneumococcal carriage.

Risk Factors for Colonization With Resistant S pneumoniae

Use of cephalosporins within the preceding 4 months, age <2 years, and having a sibling colonized with resistant S pneumoniae were significantly associated with carriage of resistant S pneumoniae (Table 6). The multivariable model confirmed that each of these was an independent risk factor (Table 7). The effect of cefixime was stronger than for other cephalosporins (adjusted OR for cefixime: 3.9; OR for all other cephalosporins combined: 2.5).

Analysis of Resistant Isolates From Sibling Pairs

Eight pairs of siblings were colonized with resistant S pneumoniae. Isolates from each pair were identical with respect to susceptibility interpretive class and within 1 dilution difference of each other with respect to the MIC of each antibiotic tested. These 16 isolates, representing 35% of the resistant pneumococci detected, were characterized further to ascertain their clonal relationships. Each pair of sibling isolates was indistinguishable on the basis of pulsed field gel electrophoresis (PFGE) analysis, serotype, and hybridization with DNA probes specific for the determinants of resistance to erythromycin (mef), tetracycline (tetm), and chloramphenicol (cat) and the epidemiologic marker lytA (Fig 1). Four of the multiresistant serotype 23F isolatesA249, A251, A363, and A364showed PFGE patterns, lytA hybridization profiles, and antibiotype characteristics indicating that they were subtype variants of the pandemic Spanish/USA clone.³⁸An additional pair of serogroup 23 isolatesA314, A315with low-level penicillin resistance were members of an S pneumoniae cluster ("USA cluster 5"), which is widely spread in the Midwestern and Western states of the United States.¹² Four serogroup 9 isolatesB295, B296, B356, and B355were identified as subtype variants of another clone widely spread in the United States,¹² Latin America,³⁹ and Europe.

View larger version (77K): [in this window] [in a new window]   Fig. 1.   Molecular typing of Streptococcus pneumoniae isolates recovered from the nasopharynx of siblings. A, PFGE analysis of chromosomal macrorestriction patterns. Sibling pairs are identified by the numbers under the brackets. The number and capital letter above the brackets identify the family and the community (A or B), respectively. Control strains for the PFGE patterns of several antibiotic-resistant clones also are included: GA 38 (prototype of the 23F multiresistant Spanish/USA epidemic clone), CA 8 (representative of the "USA cluster 5"), and GA 13 and SW 224 (variants of the penicillin-resistant serogroup 9 French/Spanish epidemic clone). Control strain SW 224 is from a Swedish collection of strains; the rest of the control strains are from a US collection.12 The SmaI fragmentation pattern of the laboratory strain R6 and the  phage low molecular weight standards (L.m.w.) are included as molecular size markers. B, Southern hybridization with a DNA probe specific for the lytA gene was performed on the SmaI hydrolysates shown in Fig 1A, as described in the "Methods" section.

	DISCUSSION

Top Abstract Methods Results Discussion Conclusion References

We describe a population-based study to compare antibiotic usage among rural communities and to assess risk factors for pneumococcal carriage and resistance. The major findings were that 1) an elevated rate of overall pneumococcal carriage and resistant pneumococcal carriage was found in the community with high cephalosporin use; 2) in individual childrenafter adjusting for age, community residence, and sibling exposurecephalosporin exposure was independently associated with carriage with resistant S pneumoniae; and 3) transmission of S pneumoniae within households was suggested by the risk factor analysis and proved by the molecular analysis of isolates from pairs of siblings. Taken together, these results confirm and extend previous observations by demonstrating the penetration of pneumococcal resistance into community populations of children who live in rural settings and by documenting the contribution of intrafamilial transmission to the dissemination of the organisms. Antibiotic selection pressure remains a driving force of pneumococcal resistance even in this rural setting.^19,2140-46

The observed variation in distribution of antibiotic use between communities is reminiscent of observations obtained in studies conducted more than 20 years ago that described significant divergences in medical practices across different communities in New England.⁴⁷ In both communities, the overall frequency of antibiotic exposure was high, such that 72% of children 8 years and 89% of children <2 years were recipients of at least 1 course of antibiotics during the 12-month period before culturing. In addition, 51% of children who did not receive antibiotics during the 12-month period had siblings who received antibiotics.

Our primary risk factor analysis was performed in 2 parts. First, we examined factors that predicted carriage among the overall population; second, we identified factors that predicted resistance among carriers. Exposure to a colonized sibling was associated with overall carriage, and exposure to a sibling colonized with resistant S pneumoniae was associated with resistant carriage. The role of intrafamilial transmission was confirmed by molecular analysis in that each pair of isolates from siblings had indistinguishable chromosomal macrorestriction profiles by PFGE analysis and also exhibited identical patterns of hybridization bands with a lytA DNA probe that was recently introduced as a molecular epidemiologic marker.³⁵ Thus, state-of-the-art molecular techniques reaffirmed results of studies conducted 25 years ago that identified frequent intrahousehold transmission of S pneumoniae, typically coincident with the onset of cold symptoms in preschool-aged children.⁴⁸ Familial transmission of resistant clones occurred in both antibiotic-exposed and -nonexposed children. Of the 18 children who carried resistant pneumococci and had not received antibiotics in the previous 4 months, 8 (44%) had a sibling with resistant pneumococci.

Child care centers, which were infrequently used in these populations, did not play a significant role in contributing to dissemination of resistant pneumococci in these rural areas, in contrast to many other epidemiologic investigations of resistant pneumococci. Conversely, other types of gatherings that involve close contact between children from different households may be more common in rural areas, particularly in highly cohesive, primarily Mormon communities. These 2 study communities differed significantly with respect to the proportion of residents who were members of the Church of Jesus Christ of Latter-day Saints. However, insufficient data were collected to address transmission of pneumococci in church or other social settings.

Only the cephalosporin class of antibiotics predicted resistance in this study. When children who were colonized with resistant pneumococci were compared with all other children, not just those who were colonized with susceptible pneumococci, cephalosporin exposure still significantly correlated with resistance, but the size of the effect was smaller. Children who carried susceptible pneumococci had a lower frequency of cephalosporin exposure than noncarriers. Thus, the dual effect of antibiotics to reduce carriage with susceptible organisms and increase colonization with resistant organisms needs to be considered when performing risk factor analyses of antibiotic resistance.

-Lactam use has been identified as a risk factor in other studies of pneumococcal resistance, most of which relied on analyses of S pneumoniae isolated from clinically directed cultures or made comparisons solely between individuals with susceptible and resistant pneumococci.²⁸ In studies in which the relative risk of cephalosporins was compared with that for penicillins, differences were not found.^15,19,49,50 A possible explanation for the higher risk associated with cephalosporins in this study is that the most heavily used cephalosporin was cefixime, an agent with relatively poor activity against Gram-positive organisms compared with other cephalosporins. Consistent with this hypothesis, in a secondary analysis of the data, the relative risk for cefixime was found to be higher than for other cephalosporins.

Recently, pneumococcal carriage was examined in children who were randomized to cefixime or amoxicillin/clavulanic acid for treatment of otitis media. Striking differences in the results of nasopharyngeal cultures were that susceptible S pneumoniae were eradicated much more effectively by amoxicillin/clavulanic acid and that acquisition of resistant S pneumoniae was 3-fold more frequent on cefixime: 19 of 21 S pneumoniae acquired during therapy in cefixime-treated patients were penicillin resistant.⁵¹ The results of the study presented here provide field data to suggest that cephalosporins with comparatively poor Gram-positive activity may have distinct effects on S pneumoniae resistance at either an individual level or a population level.

The molecular typing results suggest that importation of resistant pneumococcal clones is one mechanism by which antibiotic resistance genes appeared in the pneumococci colonizing children in these communities. Ten of the 16 isolates (5 pairs of isolates from siblings) examined by molecular typing techniques were identified as representatives of pneumococcal clones frequently recovered among disease-causing isolates in the United States. Four isolates represented subtype variants of the pandemic 23F Spanish/USA clone,³⁸ 2 were members of an S pneumoniae cluster that is widely spread in the Midwestern and Western states of the United States,¹² and 4 were subtype variants of a serotype 9 clone widely spread in the United States,¹² Latin America,³⁹ and Europe.⁵²

Limitations of this study were that the inclusion of 2 communities for surveillance cultures precluded an ecologic-level analysis and that clinical data were collected retrospectively. The lack of serial culture results also constrained our ability to analyze temporal relationships between antibiotic exposure and acquisition of resistant pneumococci.

	CONCLUSION

Top Abstract Methods Results Discussion Conclusion References

This study provides support to efforts to lower pneumococcal resistance through improved antibiotic use. One approach is to promote a reduction in overall antibiotic usage for nonsupported indications such as viral upper respiratory tract infections.^53-57 Additional studies are needed to assess the relative merit of these various strategies to bring the problem of antimicrobial resistance under better control.⁵⁸

	ACKNOWLEDGMENTS

This study was supported in part by Pfizer Inc, Abbott Laboratories Inc, and the National Institutes of Health (RO1 AT 37275).

	FOOTNOTES

Received for publication Oct 24, 2000; accepted Feb 26, 2001.

Reprint requests to (M.S.) University of Utah Department of Internal Medicine, 50 North Medical Dr, 4B319 SOM, Salt Lake City, UT 84132. E-mail: matthew.samore{at}hsc.utah.edu

	ABBREVIATIONS

MIC, minimum inhibitory concentration; PFGE, pulsed field gel electrophoresis; OR, odds ratio.

	REFERENCES

Top Abstract Methods Results Discussion Conclusion References

1. Breiman RF, Butler JC, Tenover FC, Elliott JA, Facklam RR Emergence of drug-resistant pneumococcal infections in the United States. JAMA 1994; 271:1831-1835 [Abstract/Free Full Text]
2. Campbell GD, Silberman R Drug-resistant Streptococcus pneumoniae. Clin Infect Dis 1998; 26:1188-1195 [Medline]
3. Appelbaum PC Antimicrobial resistance in Streptococcus pneumoniae: an overview. Clin Infect Dis 1992; 15:77-83 [Medline]
4. Munoz R, Musser JM, Crain M, Geographic distribution of penicillin-resistant clones of Streptococcus pneumoniae: characterization by penicillin-binding protein profile, surface protein A typing, and multilocus enzyme analysis. Clin Infect Dis 1992; 15:112-118 [Medline]
5. Tomasz A The pneumococcus at the gates. N Engl J Med 1995; 333:514-515 [Free Full Text]
6. Doern GV, Brueggemann A, Holley HP, Rauch AM Antimicrobial resistance of Streptococcus pneumoniae recovered from outpatients in the United States during the winter months of 1994 to 1995: results of a 30-center national surveillance study. Antimicrob Agents Chemother 1996; 40:1208-1213 [Abstract]
7. Tomasz A Antibiotic resistance in Streptococcus pneumoniae. Clin Infect Dis. 1997; 24:S85-S88
8. Thornsberry C, Ogilvie P, Kahn J, Mauriz Y Surveillance of antimicrobial resistance in Streptococcus pneumoniae, Haemophilus influenzae, and Moraxella catarrhalis in the United States in 1996-1997 respiratory season. The Laboratory Investigator Group. Diagn Microbiol Infect Dis. 1997; 29:249-257 [CrossRef][Medline]
9. Zighelboim S, Tomasz A Multiple antibiotic resistance in South African strains of Streptococcus pneumoniae: mechanism of resistance to beta-lactam antibiotics. Rev Infect Dis 1981; 3:267-276 [Medline]
10. Markiewicz Z, Tomasz A Variation in penicillin-binding protein patterns of penicillin-resistant clinical isolates of pneumococci. J Clin Microbiol 1989; 27:405-410 [Abstract/Free Full Text]
11. Chiou CC, Liu YC, Huang TS, Extremely high prevalence of nasopharyngeal carriage of penicillin-resistant Streptococcus pneumoniae among children in Kaohsiung, Taiwan. J Clin Microbiol 1998; 36:1933-1937 [Abstract/Free Full Text]
12. Corso A, Severina EP, Petruk VF, Mauriz YR, Tomasz A Molecular characterization of penicillin-resistant Streptococcus pneumoniae isolates causing respiratory disease in the United States. Microb Drug Resist 1998; 4:325-327 [Medline]
13. Hofmann J, Cetron MS, Farley MM, The prevalence of drug-resistant Streptococcus pneumoniae in Atlanta. N Engl J Med 1995; 333:481-486 [Abstract/Free Full Text]
14. Arason VA, Kristinsson KG, Sigurdsson JA, Stefansdottir G, Molstad S, Gudmundsson S Do antimicrobials increase the carriage rate of penicillin resistant pneumococci in children? Cross-sectional prevalence study. BMJ 1996; 313:387-391 [Abstract/Free Full Text]
15. Ford KL, Mason EO, Kaplan SL, Lamberth LB, Tillman J Factors associated with middle ear isolates of Streptococcus pneumoniae resistant to penicillin in a children's hospital. J Pediatr 1991; 119:941-944 [CrossRef][Medline]
16. Tan TQ, Mason EO, Kaplan SL Penicillin-resistant systemic pneumococcal infections in children: a retrospective case-control study. Pediatrics 1993; 92:761-767 [Abstract/Free Full Text]
17. Duchin JS, Breiman RF, Diamond A, High prevalence of multidrug-resistant Streptococcus pneumoniae among children in a rural Kentucky community. Pediatr Infect Dis J 1995; 14:745-750 [Medline]
18. Arnold KE, Leggiadro RJ, Breiman RF, Risk factors for carriage of drug-resistant Streptococcus pneumoniae among children in Memphis, Tennessee. J Pediatr 1996; 128:757-764 [CrossRef][Medline]
19. Reichler MR, Allphin AA, Breiman RF, The spread of multiply resistant Streptococcus pneumoniae at a day care center in Ohio. J Infect Dis 1992; 166:1346-1353 [Medline]
20. Doyle MG, Morrow AL, Van R, Pickering LK Intermediate resistance of Streptococcus pneumoniae to penicillin in children in day-care centers. Pediatr Infect Dis J 1992; 11:831-835 [Medline]
21. Radetsky MS, Istre GR, Johansen TL, Parmelee SW, Lauer BA, Wiesenthal AM Multiply resistant pneumococcus causing meningitis: its epidemiology within a day-care center. Lancet 1981; 2:771-773 [Medline]
22. Henderson FW, Gilligan PH, Wait K, Goff DA Nasopharyngeal carriage of antibiotic-resistant pneumococci by children in a group day care. J Infect Dis 1988; 157:256-263 [Medline]
23. Holmes SJ, Solomon SL, Morrow AL, Schwartz B, Pickering LK Risk factors for carriage of penicillin-resistant Streptococcus pneumoniae (S pneumoniae) in young children [abstract]. Pediatr Res 1997; 41:122A-122A
24. Ekdahl K, Ahlinder I, Hansson HB, Duration of nasopharyngeal carriage of penicillin-resistant Streptococcus pneumoniae: experiences from the South Swedish Pneumococcal Intervention Project. Clin Infect Dis 1997; 25:1113-1117 [Medline]
25. Mastro TD, Nomani NK, Ishaq Z, Use of nasopharyngeal isolates of Streptococcus pneumoniae and Haemophilus influenzae from children in Pakistan for surveillance for antimicrobial resistance. Pediatr Infect Dis J 1993; 12:824-830 [Medline]
26. Cherian T, Steinhoff MC, Harrison LH, Rohn D, McDougal LK, Dick J A cluster of invasive pneumococcal disease in young children in child care. JAMA 1994; 271:695-697 [Abstract/Free Full Text]
27. Ndoyo J, Siopathis RM, Klugman KP, Wasas A Antibiotic resistance among nasopharyngeal isolates of Streptococcus pneumoniae and Haemophilus influenzaeBangui, Central African Republic. MMWR Morb Mortal Wkly Rep. 1997; 46:62-64 [Medline]
28. Guillemot D, Carbon C, Balkau B, Low dosage and long treatment duration of beta-lactam: risk factors for carriage of penicillin-resistant Streptococcus pneumoniae. JAMA 1998; 279:365-370 [Abstract/Free Full Text]
29. Mainous AG, Evans ME, Hueston WJ, Titlow WB, McCown LJ Patterns of antibiotic-resistant Streptococcus pneumoniae in children in a day-care setting. J Fam Pract 1998; 46:142-146 [Medline]
30. Yagupsky P, Porat N, Fraser D, Acquisition, carriage, and transmission of pneumococci with decreased antibiotic susceptibility in young children attending a day care facility in southern Israel. J Infect Dis 1998; 177:1003-1012 [Medline]
31. National Committee for Clinical Laboratory Standards. Performance Standards for Antimicrobial Susceptibility Testing. Eighth Informational Supplement. Wayne, PA: National Committee for Clinical Laboratory Standards; 1998:1933-1937 NCCLS Document M100-S8 6[7]
32. Soares S, Kristinsson KG, Musser JM, Tomasz A Evidence for the introduction of a multiresistant clone of serotype 6B Streptococcus pneumoniae from Spain to Iceland in the late 1980s. J Infect Dis. 1993; 168:158-163 [Medline]
33. Sutcliffe J, Grebe T, Tait KA, Wondrack L Detection of erythromycin-resistant determinants by PCR. Antimicrob Agents Chemother 1996; 40:2562-2566 [Abstract]
34. Trieu-Cuot P, Poyart SC, Carlier C, Courvalin P Nucleotide sequence of the erythromycin resistance gene of the conjugative transposon Tn1545. Nucleic Acids Res 1990; 18:3660 [Free Full Text]
35. Ramirez F, Severina E, Tomasz A A high incidence of prophage carriage among natural isolates of Streptococcus pneumoniae. J Bacteriol. 1999; 181:3618-3625 [Abstract/Free Full Text]
36. McDougal LK, Facklam R, Reeves M, Analysis of multiply antimicrobial-resistant isolates of Streptococcus pneumoniae from the United States. Antimicrob Agents Chemother 1992; 36:2176-2184 [Abstract/Free Full Text]
37. Nesin M, Ramirez M, Tomasz A Capsular transformation of a multidrug-resistant Streptococcus pneumoniae in vivo. J Infect Dis 1998; 177:707-713 [Medline]
38. Munoz R, Coffey TJ, Daniels M, Intercontinental spread of a multiresistant clone of serotype 23F Streptococcus pneumoniae. J Infect Dis 1991; 164:302-306 [Medline]
39. Tomasz A, Corso A, Severina EP, Molecular epidemiologic characterization of penicillin-resistant Streptococcus pneumoniae invasive pediatric isolates recovered in six Latin-American countries: an overview. PAHO/Rockefeller University Workshop. Pan American Health Organization. Microb Drug Resist 1998; 4:195-207 [Medline]
40. Robins-Browne RM, Kharsany AB, Koornhof HJ Antibiotic-resistant pneumococci in hospitalized children. J Hyg (Lond) 1984; 93:9-16 [Medline]
41. Moreno F, Crisp C, Jorgensen JH, Patterson JE The clinical and molecular epidemiology of bacteremias at a university hospital caused by pneumococci not susceptible to penicillin. J Infect Dis 1995; 172:427-432 [Medline]
42. Boken DJ, Chartrand SA, Goering RV, Kruger R, Harrison CJ Colonization with penicillin-resistant Streptococcus pneumoniae in a child-care center. Pediatr Infect Dis J 1995; 14:879-884 [Medline]
43. Zenni MK, Cheatham SH, Thompson JM, Streptococcus pneumoniae colonization in the young child: association with otitis media and resistance to penicillin. J Pediatr 1995; 127:533-537 [CrossRef][Medline]
44. Nava JM, Bella F, Garau J, Predictive factors for invasive disease due to penicillin-resistant Streptococcus pneumoniae: a population-based study. Clin Infect Dis 1994; 19:884-890 [Medline]
45. Saah AJ, Mallonee JP, Tarpay M, Thornsberry C, Roberts MA, Rhoades ER Relative resistance to penicillin in the pneumococcus. A prevalence and case-control study. JAMA 1980; 243:1924-1927 [CrossRef][Medline]
46. Jackson MA, Shelton S, Nelson JD, McCracken GH Jr Relatively penicillin-resistant pneumococcal infections in pediatric patients. Pediatr Infect Dis J 1984; 3:129-132
47. Wennberg J, Gittelsohn Small area variations in health care delivery. Science 1973; 182:1102-1108 [Abstract/Free Full Text]
48. Gwaltney JM Jr, Sande M, Austrian R, Hendley JO Spread of Streptococcus pneumoniae in families. II. Relation of transfer of S pneumoniae to incidence of colds and serum antibody. J Infect Dis 1975; 132:62-68 [Medline]
49. Block SL, Harrison CJ, Hedrick JA, Penicillin-resistant Streptococcus pneumoniae in acute otitis media: risk factors, susceptibility patterns and antimicrobial management. Pediatr Infect Dis J 1995; 14:751-759 [Medline]
50. Welby PL, Keller DS, Cromien JL, Tebas P, Storch GA Resistance to penicillin and non-beta-lactam antibiotics of Streptococcus pneumoniae at a children's hospital. Pediatr Infect Dis J 1994; 13:281-287 [Medline]
51. Dabernat H, Geslin P, Megraud F, Effects of cefixime or co-amoxiclav treatment on nasopharyngeal carriage of Streptococcus pneumoniae and Haemophilus influenzae in children with acute otitis media. J Antimicrob Chemother 1998; 41:253-258 [Abstract/Free Full Text]
52. de Lencastre I, Kristinsson K, Brito-Avo A, Carriage of respiratory tract pathogens and molecular epidemiology of Streptococcus pneumoniae colonization in healthy children attending day care centers in Lisbon, Portugal. Microb Drug Resist 1999; 5:19-29 [Medline]
53. Stephenson J Icelandic researchers are showing the way to bring down rates of antibiotic-resistant bacteria. JAMA 1996; 275:175 [Abstract/Free Full Text]
54. Vinson DC, Lutz LJ The effect of parental expectations on treatment of children with a cough: a report from ASPN. J Fam Pract 1993; 37:23-27 [Medline]
55. Nyquist AC, Gonzales R, Steiner JF, Sande MA Antibiotic prescribing for children with colds, upper respiratory tract infections, and bronchitis. JAMA 1998; 279:875-877 [Abstract/Free Full Text]
56. Gonzales R, Sande M What will it take to stop physicians from prescribing antibiotics in acute bronchitis? Lancet 1995; 345:665-666 [CrossRef][Medline]
57. Schwartz B, Mainous AG, Marcy SM Why do physicians prescribe antibiotics for children with upper respiratory tract infections? JAMA 1998; 279:881-882 [Free Full Text]
58. Seppala H, Klaukka T, Vuopio VJ, The effect of changes in the consumption of macrolide antibiotics on erythromycin resistance in group A streptococci in Finland. Finnish Study Group for Antimicrobial Resistance. N Engl J Med 1997; 337:441-446 [Abstract/Free Full Text]