This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My File Cabinet
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Adderson, E. E.
Right arrow Articles by Pavia, A. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Adderson, E. E.
Right arrow Articles by Pavia, A. T.
Related Collections
Right arrow Infectious Disease & Immunity
Right arrowRelated AAP Red Book topics:
Haemophilus influenzae Infections
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

PEDIATRICS Vol. 108 No. 1 July 2001, p. e18

ELECTRONIC ARTICLE:
Invasive Serotype a Haemophilus influenzae Infections With a Virulence Genotype Resembling Haemophilus influenzae Type b: Emerging Pathogen in the Vaccine Era?

Elisabeth E. Adderson, MD*, **, Carrie L. Byington, MD*, LaShonda Spencer, MD*, Dagger , Amy Kimball, MD*, Musa Hindiyeh, PhD§, parallel , Karen Carroll, MDDagger , §, parallel , Susan Mottice, PhD, E. Kent Korgenski, MS#, John C. Christenson, MD*, and Andrew T. Pavia, MD*, Dagger

From the Departments of * Pediatrics, Dagger  Medicine, and § Pathology, University of Utah School of Medicine; parallel  Associated Regional and University Pathologists;  Utah Department of Health, # Primary Children's Medical Center, Salt Lake City, Utah; and ** St Jude Children's Research Center, Memphis Tennessee.



    ABSTRACT
Top
Abstract
Methods
Results
Discussion
Conclusion
References

Objective.  Haemophilus influenzae type b causes severe disease in nonimmune infants and young children; other serotypes are uncommon pathogens and thought to have low virulence. Some have hypothesized that with the virtual elimination of H influenzae type b, other serotypes might acquire virulence traits and emerge as important pathogens of children. We describe the clinical, epidemiologic, and molecular biologic features of 5 cases of severe disease attributable to Haemophilus influenzae type a.

Methods.  After observing 4 cases of invasive disease caused by H influenzae type a, we reviewed microbiology records at 3 reference laboratories that perform all serotyping in Utah and surveillance databases. Strains of H influenzae type a and control strains were examined by Southern blotting with the use of the cap probe pUO38 and by pulsed-field gel electrophoresis. The putative virulence mutation, the IS1016-bexA deletion, was detected by polymerase chain reaction amplification and sequencing.

Results.  During a 10-month period, we observed 5 children with severe invasive disease caused by H influenzae type a. No isolates of H influenzae type a had been submitted to the reference laboratories between 1992 and 1998. The median age of patients was 12 months (range: 6-48 months). Four of 5 had meningitis and bacteremia; 1 had purpura fulminans. Three isolates, representing 1 of 2 pulsed-field gel electrophoresis patterns, contained the IS1016-bexA deletion and were associated with particularly severe disease.

Conclusions.  We describe an unusual cluster of severe disease caused by H influenzae type a that resembles the clinical and epidemiologic features of H influenzae type b disease. Our data support the hypothesis that the IS1016-bexA deletion may identify more virulent strains of H influenzae. Haemophilus influenzae, epidemiology, virulence, serotyping, pathogenicity.

In the 1930s, Pittman1 described 6 serotypes of encapsulated Haemophilus influenzae (a-f), each with an antigenically distinct polysaccharide capsule. H influenzae serotype b (Hib) is highly virulent for infants and young children; non-b serotypes are rare and thought to have low virulence. Immunization with capsular polysaccharide-protein conjugate vaccines has almost eliminated invasive Hib disease in the United States and other developed countries where the vaccines are used extensively.2,3 Some have speculated that other serotypes might acquire additional virulence traits and emerge as important pathogens.4,5 However, surveillance in the United States, Great Britain, and Switzerland until now has not shown significant increases in infections of children with other serotypes.5-7

We describe 5 cases of invasive disease, including 4 cases of meningitis in young children attributable to H influenzae serotype a in Utah during a 10-month period. Three cases were attributable to a unique strain that possesses a deletion mutation associated with invasive strains of Hib but not normally found in noninvasive strains. Two of these cases, described below, were strikingly reminiscent of severe disease caused by Hib.

    CASE REPORTS

Patient 1

A previously healthy 6-month-old white female infant was brought to her primary care physician on December 11, 1998, with a 1-day history of lethargy, irritability, and poor oral intake and a brief history of altered consciousness and peripheral cyanosis. She had received 3 doses of Hib-conjugate vaccine.

On admission, the patient was lethargic with poor peripheral perfusion. Blood pressure was 40/20 mm Hg, pulse was 210 beats/min, and tympanic temperature was 39.4°C. Purpura were present on her nose, ears, and legs, and petechiae was present on her face and trunk. The anterior fontanelle was soft, and meningismus could not be elicited.

She required intubation and mechanical ventilation and fluid and inotropic support. Empiric therapy with intravenous cefotaxime, vancomycin, and gentamicin was begun. Initial laboratory studies included a white blood cell count of 4900/mm3, hematocrit of 27.5%, and a platelet count of 35 000/mm3. There was evidence of disseminated intravascular coagulation with prolonged prothrombin time and partial thromboplastin time, elevated fibrin split products, and positive d-Dimer. A sample of cerebrospinal fluid (CSF) had a white blood cell count of 738 cells/mm3, 81 red blood cells/mm3, protein of 243 mg/dL, and glucose of <20 mg/dL. Gram stain showed pleomorphic Gram-negative rods. Cultures of the CSF and blood grew mucoid colonies of H influenzae serotype a. Antimicrobial therapy was continued with ceftriaxone.

The patient had a prolonged hospital course, complicated by renal failure that required peritoneal dialysis, purpura fulminans (Fig 1), a large subdural empyema that required drainage, and persistent fever. Soft-tissue necrosis ultimately required amputation of 2 digits of her right foot and extensive debridement and skin grafting of her lower extremities. Serum quantitative immunoglobulins and total hemolytic complement levels were normal.


View larger version (97K):
[in this window]
[in a new window]
 
Fig. 1.   Purpura fulminans of patient 1 early in the course of H influenzae type a infection. Tissue necrosis led to the amputation of 2 toes, extensive debridement, and skin grafting.

Patient 2

A previously well 1-year-old white female was admitted to a referring hospital on June 31, 1999, with a 3-day history of vomiting, fever to 38.9°C, irritability, and diarrhea, followed by a generalized seizure. She had received 3 doses of Hib-CRM197 conjugate vaccine.

On admission, she had a temperature of 39.9°C. She was toxic appearing and minimally responsive. Lumbar puncture revealed cloudy CSF with 1660 white blood cells/mm3, 70 red blood cells/mm3, glucose of 34 mg/dL, and protein of 300 mg/mL. Gram stain demonstrated abundant pleomorphic Gram-negative rods. Cultures of blood and CSF grew H influenzae serotype a. Cefotaxime and vancomycin were administered. She was transferred to Primary Children's Medical Center (PCMC) on the second hospital day because of continued fever and altered mental status.

Her hospitalization was complicated by aseptic necrosis of the right femoral head and by prolonged fever. Bilateral frontoparietal subdural fluid collections were drained on the 12th hospital day, yielding 50 mL of purulent fluid. Cultures of the empyema fluid were sterile. She was treated for 4 weeks with cefotaxime with gradual improvement. On discharge, she had evidence of decreased hearing by evoked otoacoustic emission and regression of fine and gross motor skills. Immunologic evaluation---including quantitative immunoglobulins, response to diphtheria and tetanus vaccine antigens, quantification of T- and B-cell subsets, and total hemolytic and terminal complement levels---was normal.

    METHODS
Top
Abstract
Methods
Results
Discussion
Conclusion
References

Surveillance

We reviewed surveillance data from the Utah Department of Health from 1991 to 1999. We reviewed laboratory records at the 3 reference laboratories that perform virtually all reference microbiology services for Utah and the region, PCMC, Associated Regional and University Pathologists Inc, and the Utah Department of Health state laboratory. Strains of H influenzae isolated from sterile body sites at PCMC or University Hospital or strains from sterile sites referred to the microbiology laboratories at PCMC or Associated Regional and University Pathologists Inc were screened with commercial polyvalent (types a, c-f) and monovalent type b antisera for H influenzae type b capsule. All non-type b encapsulated strains were sent to the Utah Department of Health microbiology laboratory where definitive serotyping was performed with monovalent antisera for H influenzae types a through f.

Bacterial Strains

H influenzae type a strains 1 through 5 were isolated from the patients. H influenzae type b strain 11201 was supplied by Dr. Judy Daly (PCMC, Salt Lake City, UT). H influenzae type a strain ATCC 9006 was obtained from the American Type Culture Collection (Manassas, VA). Bacteria were grown on Chocolate II solid media or in brain-heart-infusion broth supplemented with 10 µg/mL hemin and 2 µg/mL nicotinamide adenine dinucleotide (Becton Dickinson Microbiology Systems, Cockeysville, MD).

Capsular Typing of Haemophilus Strains

Genotyping of Haemophilus strains was performed by Southern blot analysis using the cap probe pUO38 (provided by Dr. S. Kroll, Imperial College of Science, Technology, and Medicine, London, UK).8 Genomic DNA was prepared by proteinase K digestion, digested with EcoRI endonuclease, and subjected to agarose gel electrophoresis on a 0.8% Tris-acetate gel.9 Restriction fragments were transferred to nylon membranes (Hybond-N+; Amersham Life Science Limited, Arlington Heights, IL) and cross-linked by exposure to ultraviolet light. Membranes were prehybridized, then hybridized with fluorescein-dUTP-labeled pUO38 (Gene Images labeling and detection systems; Amersham). After washing at high stringency, blots were incubated with detection reagent and exposed to radiographic film.

Amplification of IS1016-bexA Deletion

The IS1016-bexA deletion was amplified from genomic DNA with the use of a sense IS1016 (5'ATTAGCAAGTATGCTAGTCTAT 3') and antisense bexA (5' CAATGATTCGCGTAAATAATGT 3') primers.10 Amplification reactions were performed in a 75-µL reaction mixture consisting of 300 ng of genomic DNA, 1.5 mM MgCl2, 2 mM deoxynucleotides, 50 pmol of each primer, and 4 units of high-fidelity Bio-X-Act DNA polymerase (ISC Bioexpress, Kaysville, UT), in the manufacturer's buffer. Reaction conditions consisted of denaturation at 95°C for 1 minute, annealing at 42°C for 1.5 minutes, and extension at 72 o for 2 minutes. Thirty-five rounds of amplification were performed. The predicted 362-bp amplification products were purified from agarose gels or cloned directly into pBSKII phagemid vectors (Stratagene, La Jolla CA). The cloned amplification products were sequenced with the use of an ABI2000 automated sequencer (Perkin-Elmer Corporation, Norwalk, CT). Products from a minimum of 2 independent preparations of genomic DNA and amplification reactions were sequenced.

Pulsed-Field Gel Electrophoresis

Pulsed-field gel electrophoresis (PFGE) was performed with the use of the CDC/PulseNet protocol for Gram-positive cocci. Cells were lysed with a combination of proteinase K and lysozyme. The plugs were digested at 25°C with SmaI for 4 hours. The gel was made of Seakem Gold Agarose (1%) and electrophoresed on a CHEF mapper (Bio-Rad Laboratories, Richmond, CA) for 18.5 hours using 120-degree angle ramp, ranging from 2.16 seconds to 54.17 seconds, at 6V/cm. The gel was stained with ethidium bromide and photographed under ultraviolet light. The PFGE patterns were compared with the use of Molecular Analyst Fingerprinting Plus software (Bio-Rad) by the Dice coefficient and unweighted pair group method.

    RESULTS
Top
Abstract
Methods
Results
Discussion
Conclusion
References

No cases of invasive disease caused by H influenzae type a were reported in Utah between January 1991 and November 1998. Four cases initially were identified during a 10-month period between December 1998 and October 1999. Clinical and epidemiologic characteristics are summarized in Table 1. The children ranged in age from 6 to 13 months. All had bacteremia and meningitis. Three of 4 had complications similar to those seen with invasive Hib disease, including prolonged fever, subdural empyema, and aseptic necrosis of the hip. All 4 had normal total hemolytic complement activity and normal quantitative immunoglobulins. There was no historical or hematologic evidence to suggest hyposplenism, a risk factor for severe disease with H influenzae.

                              
View this table:
[in this window]
[in a new window]
 

TABLE 1
Clinical and Epidemiologic Characteristics

A review of laboratory records revealed a single additional case of H influenzae type a disease, also summarized in Table 1. A 4-year-old boy, the youngest of 11 siblings, was admitted to the Burn Trauma Unit at University Hospital on September 18, 1999, with a flash burn to the face. Chest radiograph and oropharyngeal examination were normal. He was intubated because of concern over facial swelling. On the day after admission, he developed a fever to 38.5°C, and new lower lobe infiltrates were noted on chest radiographs. Gram-stained secretions from the endotracheal tube showed numerous polymorphonuclear cells, no squamous cells, and numerous Gram-negative coccobacillary organisms. The specimen grew H influenzae type a in pure culture.

Two of the infants with meningitis (patients 1 and 2) resided in the same county (Utah County) but in different towns. They attended separate child care centers. Patients 3 and 4 resided in Salt Lake County. Patient 3 lived in a polygamous family group with 10 other children who were younger than 10 years in 2 related households but did not attend child care. Three of 4 had been vaccinated with 3 doses of Hib-conjugate vaccines.

Hybridization of genomic DNA with pUO38 showed the genotype to be consistent with the serotype for the H influenzae type b and the type a isolates (Fig 2). Serotype a strains from patients 1, 2, and 5 exhibited the previously described a(N) Cap genotype.10 In this Cap restriction fragment polymorphism, there is a 1.2-kB reduction in the size of 1 of the probe-positive EcoRI fragments, suggesting that these strains have the IS1016-bexA deletion described in both invasive type a and type b strains.10,11


View larger version (68K):
[in this window]
[in a new window]
 
Fig. 2.   Genotyping of Haemophilus strains. Autoradiograph of Southern hybridization of EcoRI-digested DNA from type b strain Hib 11201 (lane 1) and type a strains ATCC 9006 (lane 2), Pt 1 (lane 3), Pt 2 (lane 4), Pt 5 (lane 5), Pt 3 (lane 6), and Pt 4 (lane 7) hybridized with photometrically labeled pUO38. Molecular size markers are noted at left. Strains 1, 2, and 5 have the previously described a(N) capsular genotype; strains 3 and 4 have the more common a(T) genotype.

To confirm the presence of the IS1016-bexA deletion, genomic DNA was amplified with primers corresponding to IS1016 and bexA. A 362-bp fragment was amplified from genomic DNA of each Haemophilus strain. Sequencing of these amplification products confirmed the previously described IS1016-bexA deletion (Fig 3).10 In contrast to the nucleotide sequence of previously reported invasive type a strains, the sequence of this region of the genome is identical to that of Hib strains 7004 and 11201. Previously reported invasive type a strains from Gambia had 3 to 4 base differences from the 7004 sequence that are shared by family B type b strains.10


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 3.   Nucleotide sequences of the IS1016-bexA deletion region of type b strain Hib 11201 and type a strains 1, 2, and 5. Sequences are compared with those of the previously reported type b strain RM7004 and type a 7204 and 7421 strains.3 Sequence derived from IS1016 is in capitals, sequence derived from bexA is in lower case, and an asterisk indicates the fusion site.

Three strains (patients 1, 2, and 5) had indistinguishable digest patterns (pattern I) on PFGE (Fig 4). They differed significantly from Hib and from a control strain of H influenzae type a (ATCC strain 9006; not shown). Strains from patients 3 and 4 were different from pattern I but differed from one another by 3 bands, indicating that they were closely related.12 Of interest, PFGE patterns from 2 isolates obtained from patient 3, 1 from blood and 1 from CSF, differed by 2 bands.


View larger version (125K):
[in this window]
[in a new window]
 
Fig. 4.   PFGE of chromosomal DNA. Lane 1 contains 47.5-kb lambda  marker; lane 2, H influenzae type a Pt 5; lane 3, H influenzae type a Pt 2; lane 4, H influenzae type a Pt 1; lane 5, lambda  marker; lane 6 H influenzae type a Pt 3 (CSF isolate); lane 7, H influenzae type a Pt 3 (blood isolate); lane 8, H influenzae type a Pt 4; lane 9, 47.5-kb lambda  marker.

    DISCUSSION
Top
Abstract
Methods
Results
Discussion
Conclusion
References

Serotype a H influenzae is a rare cause of invasive disease.13 In 1 large population-based study, serotype b accounted for 383 of 408 cases (94%), nontypable strains caused an additional 24 cases, and no disease caused by serotype a was noted.14 In another population-based study in 1986, 1324 of 1872 isolates (71%) from invasive disease were type b; 14 of 1872 (0.7%) were type a.6 Invasive disease caused by non-serotype b encapsulated organisms occurred almost exclusively in persons older than 5 years. Thus, the clustering of 4 cases of invasive disease and 1 of pneumonia caused by H influenzae serotype a during a 10-month period is unexpected on the basis of active and passive surveillance from a variety of sites.

In contrast to recently described H influenzae type f infections,15 the illness that we observed to be caused by H influenzae type a is strikingly reminiscent of invasive disease caused by Hib, resulting in severe disease in seemingly normal young children who are between 6 months and 2 years of age. Because anti-Haemophilus antibody elicited by the current vaccines is directed against capsular polysaccharide, these vaccines would not protect against serotype a disease. Thus, the possibility of the emergence of a new, virulent strain of H influenzae with the virulence characteristics of Hib are of concern.

Two distinct strains seem to be circulating in Utah. The 3 isolates with PFGE pattern I (patients 1, 2, and 5) seem to represent a unique clone with similar PFGE patterns and identical nucleotide sequences in the IS1016-bexA deletion region. The meningitis and sepsis caused by this organism was striking in its severity. The isolates from patients 3 and 4 seem to be related closely by the criteria proposed by Tenover et al.12 They lack the IS1016-bexA deletion.

The small number of cases precluded a case-control study to confirm risk factors, but the apparent risk factors resemble those for invasive Hib disease: young age and exposure to other children in child care settings or crowded households.

Most virulent encapsulated Haemophilus, including H influenzae type a, belong to a single large electrophoretic type, division I.16 In most division I isolates of Hib, the genes that are responsible for capsule synthesis and secretion, the Cap locus, are partially duplicated, with each segment flanked by the insertion element IS1016.17 The majority of virulent Hib strains have an 1198-bp terminal deletion in 1 duplicated segment that removes a portion of IS1016 and bexA. This deletion promotes gene amplification, resulting in a dramatic increase in capsule production that is likely to contribute to the virulence of these strains.11 Kroll et al10 described a similar mutation in 3 serotype a isolates from an outbreak in Gambia and a Kenyan isolate and postulated that this polymorphism may have resulted from genetic transfer from a serotype b strain. Haemophilus species are naturally transformable, and the Cap locus is flanked by transposable elements, features that would facilitate such genetic exchange. Although IS1016-bexA deletion is not requisite for invasive disease, our data support the hypothesis that the IS1016-bexA deletion is a marker for recombinant events and may identify unusually virulent serotype a strains. The bexA sequences of our isolates differ from those reported previously, suggesting a novel genetic event rather than the global spread of the originally described strains.

How the IS1016-bexA mutation may contribute to virulence of serotype a strains is not certain. Increased capsule may limit opsonophagocytic killing, but in serotype b strains, noncapsular factors also are critical.18 It is possible that the IS1016-bexA deletion may be linked to other genes that are important in colonization, invasion or other virulence genes. Additional dissection of the virulence mechanisms of invasive Haemophilus is needed.

    CONCLUSION
Top
Abstract
Methods
Results
Discussion
Conclusion
References

We observed an unusual increase in invasive disease caused by H influenzae type a; 2 distinct clones seem to have been circulating. Whether either clone has the potential to spread and become established remains to be seen. The ability of a strain to emerge as an important pathogen may depend not only on virulence but also on the ability to establish colonization and spread among susceptible children. Active surveillance and seroepidemiologic studies are being initiated in Utah.

    ACKNOWLEDGMENTS

This work was supported in part by Cancer Center Support CORE Grant P30 CA 21765 and the American Lebanese Syrian Associated Charities (ALSAC).

We thank Gerry Dowdle of the Utah Department of Health for assistance in reviewing surveillance data; Kim Christensen and Daren Pearce for technical assistance; Barb Schaecher and Sheri Hohmann for technical assistance with PFGE; and Dr J. Simon Kroll for supplying the capB probe pUO38.

    FOOTNOTES

Received for publication Nov 20, 2000; accepted Feb 10, 2001.

Reprint requests to (A.T.P.) Division of Infectious Diseases and Geographic Medicine, University of Utah School of Medicine, 50 North Medical Dr, Room 2R022, Salt Lake City, UT 84132. E-mail: andy.pavia{at}hsc.utah.edu

    ABBREVIATIONS

Hib, Haemophilus influenzae serotype b; CSF, cerebrospinal fluid; PCMC, Primary Children's Medical Center; PFGE, pulsed-field gel electrophoresis.

    REFERENCES
Top
Abstract
Methods
Results
Discussion
Conclusion
References
  1. Pittman M Variation and type specificity in the bacterial species Haemophilus influenzae. J Exp Med 1931; 53:471-495
  2. Bisgard KM, Kao A, Leake J, Strebel PM, Perkins BA, Wharton M Haemophilus influenzae invasive disease in the United States, 1994-1995: near disappearance of a vaccine-preventable childhood disease. Emerg Infect Dis. 1998; 4:229-237
  3. Centers for Disease Control and Prevention Progress toward eliminating Haemophilus influenzae type b disease among infants and children---United States, 1987-1997. MMWR Morb Mortal Wkly Rep. 1998; 47:993-998
  4. Lipsitch M Bacterial vaccines and serotype replacement: lessons from Haemophilus influenzae and prospects for Streptococcus pneumoniae. Emerg Infect Dis 1999; 5:336-345
  5. Muhlemann K, Balz M, Aebi S, Schopfer K Molecular characteristics of Haemophilus influenzae causing invasive disease during the period of vaccination in Switzerland: analysis of strains isolated between 1986 and 1993. J Clin Microbiol. 1996; 34:560-563
  6. Wenger JD, Pierce R, Deaver K, Invasive Haemophilus influenzae disease: a population-based evaluation of the role of capsular polysaccharide serotype. Haemophilus Influenzae Study Group. J Infect Dis 1992; 165:S34-S35
  7. Slack MP, Azzopardi HJ, Hargreaves RM, Ramsay ME Enhanced surveillance of invasive Haemophilus influenzae disease in England, 1990 to 1996: impact of conjugate vaccines. Pediatr Infect Dis J. 1998; 17:S204-S207
  8. Kroll JS, Ely S, Moxon ER Capsular typing of Haemophilus influenzae with a DNA probe. Mol Cell Probes 1991; 5:375-379
  9. Ausubel FM, Brent R, Kingston RE, et al, eds. Current Protocols in Molecular Biology. New York, NY: John Wiley & Sons, Inc; 2000. Chapter 2 (online edition). http://www.wiley.com/cp/cpmb/
  10. Kroll JS, Moxon ER, Loynds BM Natural genetic transfer of a putative virulence-enhancing mutation to Haemophilus influenzae type a. J Infect Dis 1994; 169:676-679
  11. Kroll JS, Moxon ER, Loynds BM An ancestral mutation enhancing the fitness and increasing the virulence of Haemophilus influenzae type b. J Infect Dis 1993; 168:172-176
  12. Tenover FC, Arbeit RD, Goering RV, Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 1995; 33:2233-2239
  13. Rutherford GW, Wilfert CM Invasive Haemophilus influenzae type a infections: a report of two cases and a review of the literature. Pediatr Infect Dis 1984; 3:575-577
  14. Falla TJ, Dobson SR, Crook DW, Population-based study of non-typable Haemophilus influenzae invasive disease in children and neonates. Lancet 1993; 341:851-854
  15. Urwin G, Krohn JA, Deaver-Robinson K, Wenger JD, Farley MM Invasive disease due to Haemophilus influenzae serotype f: clinical and epidemiologic characteristics in the H influenzae serotype b vaccine era. The Haemophilus Influenzae Study Group. Clin Infect Dis 1996; 22:1069-1076
  16. Musser JM, Kroll JS, Granoff DM, Global genetic structure and molecular epidemiology of encapsulated Haemophilus influenzae. Rev Infect Dis 1990; 12:75-111
  17. Kroll JS, Loynds BM, Moxon ER The Haemophilus influenzae capsulation gene cluster: a compound transposon. Mol Microbiol 1991; 5:1549-1560
  18. Zwahlen A, Kroll J, Rubin L, Moxon E The molecular basis of pathogenicity in Haemophilus influenzae: comparative virulence of genetically-related capsular transformants and correlation with changes at the capsulation locus cap. Microb Pathog 1989; 7:225-235

Pediatrics (ISSN 0031 4005). Copyright ©2001 by the American Academy of Pediatrics

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
J Med MicrobiolHome page
A. E. C. C. de Almeida, L. F. L. Schroeder, N. G. S. Caldeira, N. M. M. da Silva, P. R. Batista, M. P. Gallo, and I. de Filippis
Septic arthritis due to Haemophilus influenzae serotype a in the post-vaccination era in Brazil
J. Med. Microbiol., October 1, 2008; 57(10): 1311 - 1312.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My File Cabinet
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Adderson, E. E.
Right arrow Articles by Pavia, A. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Adderson, E. E.
Right arrow Articles by Pavia, A. T.
Related Collections
Right arrow Infectious Disease & Immunity
Right arrowRelated AAP Red Book topics:
Haemophilus influenzae Infections
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?