PEDIATRICS Vol. 108 No. 1 July 2001, p. e18
ELECTRONIC ARTICLE:
Invasive Serotype a Haemophilus influenzae
Infections With a Virulence Genotype Resembling Haemophilus
influenzae Type b: Emerging Pathogen in the Vaccine Era?
,
,, §, ,
From the Departments of * Pediatrics, Objective. Haemophilus
influenzae type b causes severe disease in nonimmune infants
and young children; other serotypes are uncommon pathogens and thought
to have low virulence. Some have hypothesized that with the virtual
elimination of H influenzae type b, other serotypes
might acquire virulence traits and emerge as important pathogens of
children. We describe the clinical, epidemiologic, and molecular
biologic features of 5 cases of severe disease attributable to
Haemophilus influenzae type a.
Methods. After observing 4 cases of invasive disease
caused by H influenzae type a, we reviewed microbiology
records at 3 reference laboratories that perform all serotyping in Utah
and surveillance databases. Strains of H influenzae type
a and control strains were examined by Southern blotting with the use
of the cap probe pUO38 and by pulsed-field gel
electrophoresis. The putative virulence mutation, the
IS1016-bexA deletion, was detected by
polymerase chain reaction amplification and sequencing.
Results. During a 10-month period, we observed 5 children
with severe invasive disease caused by H influenzae type
a. No isolates of H influenzae type a had been submitted
to the reference laboratories between 1992 and 1998. The median age of
patients was 12 months (range: 6-48 months). Four of 5 had meningitis
and bacteremia; 1 had purpura fulminans. Three isolates, representing 1 of 2 pulsed-field gel electrophoresis patterns, contained the
IS1016-bexA deletion and were associated
with particularly severe disease.
Conclusions. We describe an unusual cluster of severe
disease caused by H influenzae type a that resembles the
clinical and epidemiologic features of H influenzae type
b disease. Our data support the hypothesis that the
IS1016-bexA deletion may identify more
virulent strains of H influenzae.
Haemophilus influenzae, epidemiology, virulence,
serotyping, pathogenicity.
Medicine, and
§ Pathology, University of Utah School of Medicine; Associated
Regional and University Pathologists; ¶ Utah Department of Health,
# Primary Children's Medical Center, Salt Lake City, Utah; and ** St
Jude Children's Research Center, Memphis Tennessee.
ABSTRACT
Top
Abstract
Methods
Results
Discussion
Conclusion
References
In the 1930s, Pittman1 described 6 serotypes
of encapsulated Haemophilus influenzae (a-f), each with an
antigenically distinct polysaccharide capsule. H influenzae
serotype b (Hib) is highly virulent for infants and young children;
non-b serotypes are rare and thought to have low virulence.
Immunization with capsular polysaccharide-protein conjugate vaccines
has almost eliminated invasive Hib disease in the United States and
other developed countries where the vaccines are used
extensively.2,3 Some have speculated that other serotypes
might acquire additional virulence traits and emerge as important
pathogens.4,5 However, surveillance in the United States,
Great Britain, and Switzerland until now has not shown significant
increases in infections of children with other
serotypes.5-7
We describe 5 cases of invasive disease, including 4 cases of
meningitis in young children attributable to H influenzae
serotype a in Utah during a 10-month period. Three cases were
attributable to a unique strain that possesses a deletion mutation
associated with invasive strains of Hib but not normally found in
noninvasive strains. Two of these cases, described below, were
strikingly reminiscent of severe disease caused by Hib.
Patient 1
A previously healthy 6-month-old white female infant was brought
to her primary care physician on December 11, 1998, with a 1-day
history of lethargy, irritability, and poor oral intake and a brief
history of altered consciousness and peripheral cyanosis. She had
received 3 doses of Hib-conjugate vaccine.
On admission, the patient was lethargic with poor peripheral perfusion.
Blood pressure was 40/20 mm Hg, pulse was 210 beats/min, and tympanic
temperature was 39.4°C. Purpura were present on her nose, ears, and
legs, and petechiae was present on her face and trunk. The anterior
fontanelle was soft, and meningismus could not be elicited.
She required intubation and mechanical ventilation and fluid and
inotropic support. Empiric therapy with intravenous cefotaxime, vancomycin, and gentamicin was begun. Initial laboratory studies included a white blood cell count of 4900/mm3,
hematocrit of 27.5%, and a platelet count of
35 000/mm3. There was evidence of disseminated
intravascular coagulation with prolonged prothrombin time and partial
thromboplastin time, elevated fibrin split products, and positive
d-Dimer. A sample of cerebrospinal fluid (CSF) had a white blood cell
count of 738 cells/mm3, 81 red blood
cells/mm3, protein of 243 mg/dL, and glucose of
<20 mg/dL. Gram stain showed pleomorphic Gram-negative rods. Cultures
of the CSF and blood grew mucoid colonies of H influenzae
serotype a. Antimicrobial therapy was continued with ceftriaxone.
The patient had a prolonged hospital course, complicated by renal
failure that required peritoneal dialysis, purpura fulminans (Fig
1), a large subdural empyema that
required drainage, and persistent fever. Soft-tissue necrosis
ultimately required amputation of 2 digits of her right foot and
extensive debridement and skin grafting of her lower extremities. Serum
quantitative immunoglobulins and total hemolytic complement levels were
normal.
CASE REPORTS
View larger version (97K):
[in a new window]
Fig. 1.
Purpura fulminans of patient 1 early in the course of H
influenzae type a infection. Tissue necrosis led to the
amputation of 2 toes, extensive debridement, and skin grafting.
Patient 2
A previously well 1-year-old white female was admitted to a referring hospital on June 31, 1999, with a 3-day history of vomiting, fever to 38.9°C, irritability, and diarrhea, followed by a generalized seizure. She had received 3 doses of Hib-CRM197 conjugate vaccine.
On admission, she had a temperature of 39.9°C. She was toxic appearing and minimally responsive. Lumbar puncture revealed cloudy CSF with 1660 white blood cells/mm3, 70 red blood cells/mm3, glucose of 34 mg/dL, and protein of 300 mg/mL. Gram stain demonstrated abundant pleomorphic Gram-negative rods. Cultures of blood and CSF grew H influenzae serotype a. Cefotaxime and vancomycin were administered. She was transferred to Primary Children's Medical Center (PCMC) on the second hospital day because of continued fever and altered mental status.
Her hospitalization was complicated by aseptic necrosis of the right
femoral head and by prolonged fever. Bilateral frontoparietal subdural
fluid collections were drained on the 12th hospital day, yielding 50 mL
of purulent fluid. Cultures of the empyema fluid were sterile. She was
treated for 4 weeks with cefotaxime with gradual improvement. On
discharge, she had evidence of decreased hearing by evoked otoacoustic
emission and regression of fine and gross motor skills. Immunologic
evaluation
including quantitative immunoglobulins, response to
diphtheria and tetanus vaccine antigens, quantification of T- and
B-cell subsets, and total hemolytic and terminal complement levelswas
normal.
| |
METHODS |
|---|
|
Top
Abstract
Methods
Results
Discussion
Conclusion
References
|
|---|
Surveillance
We reviewed surveillance data from the Utah Department of Health from 1991 to 1999. We reviewed laboratory records at the 3 reference laboratories that perform virtually all reference microbiology services for Utah and the region, PCMC, Associated Regional and University Pathologists Inc, and the Utah Department of Health state laboratory. Strains of H influenzae isolated from sterile body sites at PCMC or University Hospital or strains from sterile sites referred to the microbiology laboratories at PCMC or Associated Regional and University Pathologists Inc were screened with commercial polyvalent (types a, c-f) and monovalent type b antisera for H influenzae type b capsule. All non-type b encapsulated strains were sent to the Utah Department of Health microbiology laboratory where definitive serotyping was performed with monovalent antisera for H influenzae types a through f.
Bacterial Strains
H influenzae type a strains 1 through 5 were isolated from the patients. H influenzae type b strain 11201 was supplied by Dr. Judy Daly (PCMC, Salt Lake City, UT). H influenzae type a strain ATCC 9006 was obtained from the American Type Culture Collection (Manassas, VA). Bacteria were grown on Chocolate II solid media or in brain-heart-infusion broth supplemented with 10 µg/mL hemin and 2 µg/mL nicotinamide adenine dinucleotide (Becton Dickinson Microbiology Systems, Cockeysville, MD).
Capsular Typing of Haemophilus Strains
Genotyping of Haemophilus strains was performed by Southern blot analysis using the cap probe pUO38 (provided by Dr. S. Kroll, Imperial College of Science, Technology, and Medicine, London, UK).8 Genomic DNA was prepared by proteinase K digestion, digested with EcoRI endonuclease, and subjected to agarose gel electrophoresis on a 0.8% Tris-acetate gel.9 Restriction fragments were transferred to nylon membranes (Hybond-N+; Amersham Life Science Limited, Arlington Heights, IL) and cross-linked by exposure to ultraviolet light. Membranes were prehybridized, then hybridized with fluorescein-dUTP-labeled pUO38 (Gene Images labeling and detection systems; Amersham). After washing at high stringency, blots were incubated with detection reagent and exposed to radiographic film.
Amplification of IS1016-bexA Deletion
The IS1016-bexA deletion was amplified from genomic DNA with the use of a sense IS1016 (5'ATTAGCAAGTATGCTAGTCTAT 3') and antisense bexA (5' CAATGATTCGCGTAAATAATGT 3') primers.10 Amplification reactions were performed in a 75-µL reaction mixture consisting of 300 ng of genomic DNA, 1.5 mM MgCl2, 2 mM deoxynucleotides, 50 pmol of each primer, and 4 units of high-fidelity Bio-X-Act DNA polymerase (ISC Bioexpress, Kaysville, UT), in the manufacturer's buffer. Reaction conditions consisted of denaturation at 95°C for 1 minute, annealing at 42°C for 1.5 minutes, and extension at 72 o for 2 minutes. Thirty-five rounds of amplification were performed. The predicted 362-bp amplification products were purified from agarose gels or cloned directly into pBSKII phagemid vectors (Stratagene, La Jolla CA). The cloned amplification products were sequenced with the use of an ABI2000 automated sequencer (Perkin-Elmer Corporation, Norwalk, CT). Products from a minimum of 2 independent preparations of genomic DNA and amplification reactions were sequenced.
Pulsed-Field Gel Electrophoresis
Pulsed-field gel electrophoresis (PFGE) was performed with the use of the CDC/PulseNet protocol for Gram-positive cocci. Cells were lysed with a combination of proteinase K and lysozyme. The plugs were digested at 25°C with SmaI for 4 hours. The gel was made of Seakem Gold Agarose (1%) and electrophoresed on a CHEF mapper (Bio-Rad Laboratories, Richmond, CA) for 18.5 hours using 120-degree angle ramp, ranging from 2.16 seconds to 54.17 seconds, at 6V/cm. The gel was stained with ethidium bromide and photographed under ultraviolet light. The PFGE patterns were compared with the use of Molecular Analyst Fingerprinting Plus software (Bio-Rad) by the Dice coefficient and unweighted pair group method.
| |
RESULTS |
|---|
|
Top
Abstract
Methods
Results
Discussion
Conclusion
References
|
|---|
No cases of invasive disease caused by H influenzae type a were reported in Utah between January 1991 and November 1998. Four cases initially were identified during a 10-month period between December 1998 and October 1999. Clinical and epidemiologic characteristics are summarized in Table 1. The children ranged in age from 6 to 13 months. All had bacteremia and meningitis. Three of 4 had complications similar to those seen with invasive Hib disease, including prolonged fever, subdural empyema, and aseptic necrosis of the hip. All 4 had normal total hemolytic complement activity and normal quantitative immunoglobulins. There was no historical or hematologic evidence to suggest hyposplenism, a risk factor for severe disease with H influenzae.
|
A review of laboratory records revealed a single additional case of H influenzae type a disease, also summarized in Table 1. A 4-year-old boy, the youngest of 11 siblings, was admitted to the Burn Trauma Unit at University Hospital on September 18, 1999, with a flash burn to the face. Chest radiograph and oropharyngeal examination were normal. He was intubated because of concern over facial swelling. On the day after admission, he developed a fever to 38.5°C, and new lower lobe infiltrates were noted on chest radiographs. Gram-stained secretions from the endotracheal tube showed numerous polymorphonuclear cells, no squamous cells, and numerous Gram-negative coccobacillary organisms. The specimen grew H influenzae type a in pure culture.
Two of the infants with meningitis (patients 1 and 2) resided in the same county (Utah County) but in different towns. They attended separate child care centers. Patients 3 and 4 resided in Salt Lake County. Patient 3 lived in a polygamous family group with 10 other children who were younger than 10 years in 2 related households but did not attend child care. Three of 4 had been vaccinated with 3 doses of Hib-conjugate vaccines.
Hybridization of genomic DNA with pUO38 showed the genotype to be consistent with the serotype for the H influenzae type b and the type a isolates (Fig 2). Serotype a strains from patients 1, 2, and 5 exhibited the previously described a(N) Cap genotype.10 In this Cap restriction fragment polymorphism, there is a 1.2-kB reduction in the size of 1 of the probe-positive EcoRI fragments, suggesting that these strains have the IS1016-bexA deletion described in both invasive type a and type b strains.10,11
|
To confirm the presence of the IS1016-bexA deletion, genomic DNA was amplified with primers corresponding to IS1016 and bexA. A 362-bp fragment was amplified from genomic DNA of each Haemophilus strain. Sequencing of these amplification products confirmed the previously described IS1016-bexA deletion (Fig 3).10 In contrast to the nucleotide sequence of previously reported invasive type a strains, the sequence of this region of the genome is identical to that of Hib strains 7004 and 11201. Previously reported invasive type a strains from Gambia had 3 to 4 base differences from the 7004 sequence that are shared by family B type b strains.10
|
Three strains (patients 1, 2, and 5) had indistinguishable digest patterns (pattern I) on PFGE (Fig 4). They differed significantly from Hib and from a control strain of H influenzae type a (ATCC strain 9006; not shown). Strains from patients 3 and 4 were different from pattern I but differed from one another by 3 bands, indicating that they were closely related.12 Of interest, PFGE patterns from 2 isolates obtained from patient 3, 1 from blood and 1 from CSF, differed by 2 bands.
|
marker; lane 2, H influenzae type a Pt 5; lane 3, H
influenzae type a Pt 2; lane 4, H influenzae
type a Pt 1; lane 5, | |
DISCUSSION |
|---|
|
Top
Abstract
Methods
Results
Discussion
Conclusion
References
|
|---|
Serotype a H influenzae is a rare cause of invasive disease.13 In 1 large population-based study, serotype b accounted for 383 of 408 cases (94%), nontypable strains caused an additional 24 cases, and no disease caused by serotype a was noted.14 In another population-based study in 1986, 1324 of 1872 isolates (71%) from invasive disease were type b; 14 of 1872 (0.7%) were type a.6 Invasive disease caused by non-serotype b encapsulated organisms occurred almost exclusively in persons older than 5 years. Thus, the clustering of 4 cases of invasive disease and 1 of pneumonia caused by H influenzae serotype a during a 10-month period is unexpected on the basis of active and passive surveillance from a variety of sites.
In contrast to recently described H influenzae type f infections,15 the illness that we observed to be caused by H influenzae type a is strikingly reminiscent of invasive disease caused by Hib, resulting in severe disease in seemingly normal young children who are between 6 months and 2 years of age. Because anti-Haemophilus antibody elicited by the current vaccines is directed against capsular polysaccharide, these vaccines would not protect against serotype a disease. Thus, the possibility of the emergence of a new, virulent strain of H influenzae with the virulence characteristics of Hib are of concern.
Two distinct strains seem to be circulating in Utah. The 3 isolates with PFGE pattern I (patients 1, 2, and 5) seem to represent a unique clone with similar PFGE patterns and identical nucleotide sequences in the IS1016-bexA deletion region. The meningitis and sepsis caused by this organism was striking in its severity. The isolates from patients 3 and 4 seem to be related closely by the criteria proposed by Tenover et al.12 They lack the IS1016-bexA deletion.
The small number of cases precluded a case-control study to confirm risk factors, but the apparent risk factors resemble those for invasive Hib disease: young age and exposure to other children in child care settings or crowded households.
Most virulent encapsulated Haemophilus, including H influenzae type a, belong to a single large electrophoretic type, division I.16 In most division I isolates of Hib, the genes that are responsible for capsule synthesis and secretion, the Cap locus, are partially duplicated, with each segment flanked by the insertion element IS1016.17 The majority of virulent Hib strains have an 1198-bp terminal deletion in 1 duplicated segment that removes a portion of IS1016 and bexA. This deletion promotes gene amplification, resulting in a dramatic increase in capsule production that is likely to contribute to the virulence of these strains.11 Kroll et al10 described a similar mutation in 3 serotype a isolates from an outbreak in Gambia and a Kenyan isolate and postulated that this polymorphism may have resulted from genetic transfer from a serotype b strain. Haemophilus species are naturally transformable, and the Cap locus is flanked by transposable elements, features that would facilitate such genetic exchange. Although IS1016-bexA deletion is not requisite for invasive disease, our data support the hypothesis that the IS1016-bexA deletion is a marker for recombinant events and may identify unusually virulent serotype a strains. The bexA sequences of our isolates differ from those reported previously, suggesting a novel genetic event rather than the global spread of the originally described strains.
How the IS1016-bexA mutation may contribute to virulence of serotype a strains is not certain. Increased capsule may limit opsonophagocytic killing, but in serotype b strains, noncapsular factors also are critical.18 It is possible that the IS1016-bexA deletion may be linked to other genes that are important in colonization, invasion or other virulence genes. Additional dissection of the virulence mechanisms of invasive Haemophilus is needed.
| |
CONCLUSION |
|---|
|
Top
Abstract
Methods
Results
Discussion
Conclusion
References
|
|---|
We observed an unusual increase in invasive disease caused by H influenzae type a; 2 distinct clones seem to have been circulating. Whether either clone has the potential to spread and become established remains to be seen. The ability of a strain to emerge as an important pathogen may depend not only on virulence but also on the ability to establish colonization and spread among susceptible children. Active surveillance and seroepidemiologic studies are being initiated in Utah.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported in part by Cancer Center Support CORE Grant P30 CA 21765 and the American Lebanese Syrian Associated Charities (ALSAC).
We thank Gerry Dowdle of the Utah Department of Health for assistance in reviewing surveillance data; Kim Christensen and Daren Pearce for technical assistance; Barb Schaecher and Sheri Hohmann for technical assistance with PFGE; and Dr J. Simon Kroll for supplying the capB probe pUO38.
| |
FOOTNOTES |
|---|
Received for publication Nov 20, 2000; accepted Feb 10, 2001.
Reprint requests to (A.T.P.) Division of Infectious Diseases and Geographic Medicine, University of Utah School of Medicine, 50 North Medical Dr, Room 2R022, Salt Lake City, UT 84132. E-mail: andy.pavia{at}hsc.utah.edu
| |
ABBREVIATIONS |
|---|
Hib, Haemophilus influenzae serotype b; CSF, cerebrospinal fluid; PCMC, Primary Children's Medical Center; PFGE, pulsed-field gel electrophoresis.
| |
REFERENCES |
|---|
|
Top
Abstract
Methods
Results
Discussion
Conclusion
References
|
|---|
- Pittman M Variation and type specificity in the bacterial species Haemophilus influenzae. J Exp Med 1931; 53:471-495
- Bisgard KM, Kao A, Leake J, Strebel PM, Perkins BA, Wharton M Haemophilus influenzae invasive disease in the United States, 1994-1995: near disappearance of a vaccine-preventable childhood disease. Emerg Infect Dis. 1998; 4:229-237
-
Centers for Disease Control and Prevention
Progress toward eliminating
Haemophilus influenzae type b disease among infants and
childrenUnited States, 1987-1997.
MMWR Morb Mortal Wkly
Rep.
1998;
47:993-998
- Lipsitch M Bacterial vaccines and serotype replacement: lessons from Haemophilus influenzae and prospects for Streptococcus pneumoniae. Emerg Infect Dis 1999; 5:336-345
- Muhlemann K, Balz M, Aebi S, Schopfer K Molecular characteristics of Haemophilus influenzae causing invasive disease during the period of vaccination in Switzerland: analysis of strains isolated between 1986 and 1993. J Clin Microbiol. 1996; 34:560-563
- Wenger JD, Pierce R, Deaver K, Invasive Haemophilus influenzae disease: a population-based evaluation of the role of capsular polysaccharide serotype. Haemophilus Influenzae Study Group. J Infect Dis 1992; 165:S34-S35
- Slack MP, Azzopardi HJ, Hargreaves RM, Ramsay ME Enhanced surveillance of invasive Haemophilus influenzae disease in England, 1990 to 1996: impact of conjugate vaccines. Pediatr Infect Dis J. 1998; 17:S204-S207
- Kroll JS, Ely S, Moxon ER Capsular typing of Haemophilus influenzae with a DNA probe. Mol Cell Probes 1991; 5:375-379
- Ausubel FM, Brent R, Kingston RE, et al, eds. Current Protocols in Molecular Biology. New York, NY: John Wiley & Sons, Inc; 2000. Chapter 2 (online edition). http://www.wiley.com/cp/cpmb/
- Kroll JS, Moxon ER, Loynds BM Natural genetic transfer of a putative virulence-enhancing mutation to Haemophilus influenzae type a. J Infect Dis 1994; 169:676-679
- Kroll JS, Moxon ER, Loynds BM An ancestral mutation enhancing the fitness and increasing the virulence of Haemophilus influenzae type b. J Infect Dis 1993; 168:172-176
- Tenover FC, Arbeit RD, Goering RV, Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 1995; 33:2233-2239
- Rutherford GW, Wilfert CM Invasive Haemophilus influenzae type a infections: a report of two cases and a review of the literature. Pediatr Infect Dis 1984; 3:575-577
- Falla TJ, Dobson SR, Crook DW, Population-based study of non-typable Haemophilus influenzae invasive disease in children and neonates. Lancet 1993; 341:851-854
- Urwin G, Krohn JA, Deaver-Robinson K, Wenger JD, Farley MM Invasive disease due to Haemophilus influenzae serotype f: clinical and epidemiologic characteristics in the H influenzae serotype b vaccine era. The Haemophilus Influenzae Study Group. Clin Infect Dis 1996; 22:1069-1076
- Musser JM, Kroll JS, Granoff DM, Global genetic structure and molecular epidemiology of encapsulated Haemophilus influenzae. Rev Infect Dis 1990; 12:75-111
- Kroll JS, Loynds BM, Moxon ER The Haemophilus influenzae capsulation gene cluster: a compound transposon. Mol Microbiol 1991; 5:1549-1560
- Zwahlen A, Kroll J, Rubin L, Moxon E The molecular basis of pathogenicity in Haemophilus influenzae: comparative virulence of genetically-related capsular transformants and correlation with changes at the capsulation locus cap. Microb Pathog 1989; 7:225-235
Pediatrics (ISSN 0031 4005). Copyright ©2001 by the American Academy of Pediatrics
CiteULike 
Connotea 
Del.icio.us 
Digg 
Facebook 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
|
|
 |
|
  A. E. C. C. de Almeida, L. F. L. Schroeder, N. G. S. Caldeira, N. M. M. da Silva, P. R. Batista, M. P. Gallo, and I. de Filippis Septic arthritis due to Haemophilus influenzae serotype a in the post-vaccination era in Brazil J. Med. Microbiol., October 1, 2008; 57(10): 1311 - 1312. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
