 |
|
 |
|
 |
 |
|
 |
 |
 |
 |
 |
 |
 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
,,,
,,,, ¶
From the Departments of * Pediatrics and Clinical Science,
Alfred I. duPont Institute, Wilmington, Delaware; the § Division of
Endocrinology and Metabolism, the ¶ Department of Pediatrics, Jefferson
Medical College of Thomas Jefferson University, Philadelphia,
Pennsylvania; and the Department of Neonatology, Medical Center of
Delaware, Christiana, Delaware.
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
ACKNOWLEDGMENTS
ABBREVIATIONS
REFERENCES
ABSTRACT 
Background. Leptin, the protein product of the ob gene, is produced by the adipocyte and seems to function as a link between adiposity, satiety, and activity. Leptin has also been found to be necessary for pubertal development, conception, and pregnancy in mice, and is increased in prepubertal children, independent of adiposity, suggesting a role in childhood growth and development. This study investigated 100 mother/newborn pairs to determine the role of leptin in neonatal development. Placental tissue was assayed for leptin mRNA to evaluate it as a source of leptin production in utero.
Methods. One hundred mother/newborn pairs were enrolled in this study. Radioimmunoassay was performed for leptin on maternal venous and newborn cord blood. Leptin concentrations were measured in 43 children in Tanner stages 1 and 2 as a control group. Placental tissue was obtained from five mothers and assayed for leptin mRNA by reverse transcription/polymerase chain reaction (RT/PCR). Human placental cell lines JAR and JEG-3 were also assayed for leptin mRNA expression.
Results. Leptin was present in all newborns studied at a mean concentration of 8.8 ng/mL (±9.6 standard deviations). Leptin concentrations in cord blood correlated with newborn weight (r = .51), body mass index (BMI) (r = .48), and arm fat (r = .42). There was no correlation between leptin and insulin. When statistically covarying for adiposity for newborns and Tanner stages 1 and 2 children, newborns had greater concentrations of leptin (mean, 10.57 ng/mL) than children (mean, 3.04 ng/mL). Leptin was present in all mothers at a mean value of 28.8 ng/mL (±22.2 standard deviations). Leptin concentration correlated with prepregnancy BMI (r = .56), BMI at time of delivery (r = .74), and arm fat (r = .73). Maternal leptin correlated with serum insulin (r = .49). There was no correlation between maternal and newborn leptin concentrations. Thirteen percent of newborns had higher leptin concentrations than their mothers. Placental tissue from five separate placentas expressed leptin mRNA at comparable or greater levels than adipose tissue. Two human trophoblastic placental cell lines, JAR and JEG-3, also expressed leptin mRNA.
Conclusions. The correlation between leptin and adiposity found in children and adults was also found in newborns. Serum leptin concentrations in newborns were increased more than three-fold compared with children in Tanner stages 1 and 2 when controlling for adiposity, suggesting that leptin concentrations in the newborn are not explained by adiposity alone. Maternal leptin concentrations correlated with measures of adiposity at delivery but did not correlate with newborn adiposity or leptin. Leptin mRNA was expressed both in placental tissue and in two human placental cell lines. These data suggest that leptin has a role in intrauterine and neonatal development and that the placenta provides a source of leptin for the growing fetus.
Key words: leptin, newborn, fetus, placenta.INTRODUCTION
Leptin, the adipocyte-specific protein product of the ob gene,1 has been linked in mice to the body's system of energy regulation. It has been hypothesized that leptin is integral in the feedback loop from adipose tissue stores to satiety centers in the hypothalamus, resulting in a decrease in appetite and an increase in energy expenditure.2 Ob/ob mice, which lack leptin, are obese and lose weight with exogenous leptin administration.3 In humans, serum leptin concentrations have been found to correlate directly with measures of adipose tissue stores.6 Increased serum leptin concentrations in obese adults and children6,7 suggest that obesity may be associated with an alteration in the feedback loop between central appetite and satiety centers.
Hassink et al7 hypothesized that leptin serves an additional role in the child's dynamic energy needs necessary for growth and development. In a previous study,7 leptin concentrations were found to vary with Tanner stage in children independent of adiposity. Higher leptin levels were found at Tanner stages 1 and 2 as compared with Tanner stage 5. The suggestion that leptin is central to development in animals was provided by Barash et al,8 who treated infertile ob/ob mice with leptin and found that leptin-treated females had significantly elevated serum levels of luteinizing hormone and increased ovarian and uterine weights. Chehab et al9 corrected the sterility defect in female ob/ob mice using human recombinant leptin administration.
The role of leptin in the neonatal period, a time of rapid growth and development,10 is poorly understood. Frazer-Llado et al11 reported low serum leptin concentrations in critically ill infants during their stay in the intensive care unit. Leptin concentrations in these infants did not correlate with weight. In contrast, Schubring et al12 using a small sample of full term infants (n = 15), reported moderate significant correlations between leptin concentrations in cord blood and newborn weight. There were no correlations between maternal leptin concentrations and birth weight.
In the present study, a representative sample of 100 healthy newborns was studied to determine the association between serum leptin concentrations and adiposity. Serum leptin concentrations were then compared between newborns and children at Tanner stages 1 and 2 by controlling for levels of adiposity. Mother and newborn serum leptin concentrations were also studied. Subsequently, placental tissue was assayed for leptin mRNA to evaluate possible sources of leptin production because of the lack of association between mother and newborn leptin levels.
METHODS
Study Subjects
One hundred consecutive pregnant women and their newborns were enrolled in this study. Anthropometric measurements and blood sampling of mother and newborn were performed at the time of delivery. Table 1 presents demographic and anthropometric data for mothers and newborns. This was the first pregnancy for 31 of the mothers, the second for 28, the third for 19, and the fourth or greater pregnancy for 20 mothers with information on two pregnancies not available. Mean maternal BMI (body mass index) before pregnancy was 26.17 [ ±7.55 (SD)]. Three percent of the newborns had gestational ages of 32 weeks or less. Twenty-seven deliveries were by caesarean section. Informed consent was obtained from the mothers for themselves and their newborns. This study was approved by the Institutional Review Boards of the Alfred I. duPont Institute and the two birthplace hospitals, Thomas Jefferson University Hospital and the Medical Center of Delaware.|
Table 1. Means and Standard Deviations for Demographic and Anthropometric Variables in Mothers and Newborns |
Procedures
Maternal height was measured to the nearest cm by stadiometer; weight was measured to the nearest .1 kg on a balance beam scale, and BMI was calculated by dividing the weight in kilograms by the height in meters squared. Triceps skinfold was measured at the mid-arm distance to the nearest millimeter using Lange calipers. Arm fat was calculated from the measured mid-arm circumference and triceps skinfold according to the formulas provided by Must and colleagues.13 Prepregnancy weight was obtained by history.
70°C until analysis. Radioimmunoassay (Linco Research, St. Charles,
MO) for serum leptin was performed as previously described by Considine
et al.6 Serum insulin was measured by radioimmunoassay
(Linco Research, St. Charles, MO), and serum glucose was measured by
the glucose oxidase method with a glucose analyzer 29 (Beckman, Brea,
CA).
Cell Lines and Tissues
Biopsies of both subcutaneous and abdominal fat were obtained from children undergoing orthopedic surgery. A biopsy of abdominal fat was obtained from an obese pregnant woman. Human placental cell lines, JAR14 and JEG-3,15 were obtained from the American Type Culture Collection (Rockville, MD). JAR cells were grown in RPMI medium 1640 with 10% (vol/vol) fetal calf serum and penicillin-streptomycin, and JEG-3 cells were cultured in
-MEM
medium with 15% (vol/vol) fetal calf serum and
penicillin-streptomycin.
RNA Isolation and RT/PCR Analysis
After cells reached confluence, total RNA was extracted using the RNeasy kit (Qiagen, Chatsworth, CA) according to the manufacturer's instructions. Placental tissues were frozen in liquid nitrogen, pulverized with a mortar and pestle, and total RNA was extracted as described above. Total RNA from two additional human placentas was obtained from Clontech (Palo Alto, CA). RNA concentration and purity were determined by absorbency at 260 and 280 nm. One microgram of total RNA was reverse-transcribed using avian myeloblastosis virus and oligo (dT) primer (Promega, Madison, WI), according to the manufacturer's instructions. The reverse transcription reaction was performed at 42°C for 15 min. Subsequent amplification of the cDNA sequence was performed with 10 µL of the reverse transcription reaction in 1X Taq buffer, 5% dimethylsulfoxide, 25 pmol each of leptin exon 2 forward (5
CATTGGGGAACCCTGTGCGGATTC3) and exon 3 reverse
(5TGGCAGCTCTTAGAGAAGGCCAGC3) PCR primers, and 1.25 U Taq
polymerase in a 50-µL reaction volume. For assessment of the relative
levels of leptin to 
-actin, a multiplex RT/PCR approach was used as
described by Dukas et al.16 The PCR reaction was done as
described above except that the -actin primers (forward: 5TGTATGCCTCTGGTCGTACCAC3; reverse: 5ACAGAGTACTTGCGCTCAGGAG3) were
added at 6.25 pmol/µL. The temperature profile for the PCR reactions
consisted of a 2-min melting step at 95°C, then 30 cycles of 30 s at 94°C, 30 s at 55°C, and 90 sec at 65°C, followed by a
final extension step of 6 min at 65°C. Independent experiments established that 30 cycles were within the linear range of the multiplex PCR assay. RT/PCR products were separated by size on a 4%
agarose gel and stained with ethidium bromide. Images were transferred
to an Apple MacIntosh Quadra 800 via an Eagle Eye still video imaging
system, and the relative band intensities analyzed with National Center
for Supercomputing Applications Gelreader Version 2.07 software.
Statistical Analysis
Because of variation in the distribution of serum leptin concentrations and estimates of percentage body fat, the relations between continuous variables were evaluated by Spearman rank correlations. A log (Ln) transformation of serum leptin levels was performed to normalize the distribution of values to meet the assumptions for subsequent analyses. All analyses were performed using the general factorial analyses of covariance model, controlling for the effects of both BMI and upper arm fat. Arm fat and BMI were selected as covariates because of their high correlations with serum leptin concentrations.6,7 Post hoc (Tukey) analyses were performed to determine differences between males and females, and between newborns and Tanner stage 1 and 2 children. Post hoc power contrast yielded power estimates
.80 for all comparisons. Data are
presented as the mean and (±) standard deviation, and a
P < .05 was used as a determinant of statistical
significance. All analyses were two tailed and conducted with the SPSS
software (version 6.1.3 for Windows, SPSS Inc, Chicago, IL).
RESULTS
Newborn Data
Table 1 presents newborn demographic and anthropometric data. Leptin was present in all newborns studied. Leptin concentrations in cord blood correlated with newborn weight (r = .51; P < .001), BMI (r = .48; P < .001), and arm fat (r = .42; P < .001). Correlation between newborn leptin, insulin, or glucose levels failed to reach significance (Table 2).|
Table 2. Means and Standard Deviations for Laboratory Variables in Mothers and Newborns |
Newborn Childhood Comparisons
A 2 (group) × 2 (gender) general factorial analyses of covariance model was performed between newborns and children at Tanner stages 1 and 2 with BMI and arm fat as covariates. Newborns had greater concentrations of leptin (mean, 10.57 ng/mL) than Tanner stage 1 and 2 children (mean, 3.04 ng/mL; P < .001). A significant main effect was found for gender, with females (mean, 7.11 ng/mL) demonstrating higher leptin concentrations than males (mean, 4.52 ng/mL; P < .001).Maternal Data
Table 1 presents demographic and anthropometric data for mothers. Leptin was present in all mothers studied. Leptin concentrations correlated with prepregnancy BMI (r = .56; P < .001), BMI at time of delivery (r = .74; P < .001), and arm fat (r = .73; P < .001). Maternal serum leptin concentrations correlated with serum insulin levels (r = .49; P < .001) but had no relationship to serum glucose (Table 2).Mother/Newborn Dyad
Correlations between maternal and newborn serum leptin concentrations, insulin, and glucose failed to reach significance. Figure 1 and Figure 2 depict the relationship between arm fat, BMI, and log leptin concentrations in newborns and mothers. Thirteen percent of newborns had higher leptin concentrations than did their mothers.
Placental Tissue
Placental tissue from five women was examined for expression of leptin mRNA by RT/PCR analysis. Placental tissue showed high expression of leptin mRNA (Fig 3, lane 1). PCR primers that flanked the entire leptin coding sequence were also used to amplify leptin mRNA from placenta and abdominal fat. A PCR product of the appropriate size [~600 base pairs (bp)] was obtained (data not shown). Sequence analysis proved that the RT/PCR product amplified from placenta was identical with the reported human leptin cDNA sequence (GenBank accession no. D49487[GenBank]).
-actin PCR primers (lanes 5 to 7)
as described in Methods. Lanes 1, 5: placenta; lanes 2, 6: child
abdominal fat; lanes 3, 7: obese pregnant adult abdominal fat; lane 4:
JEG-3 placental cells. Markers (M) are 1000, 700, 525, 500, 400, 300, and 200 bp. The size of the leptin RT/PCR product is 348 bp; the size
of the -actin RT/PCR product is 592 bp.
-actin mRNA by
multiplex RT/PCR revealed that placenta contained from 1 to 2.5 times
the amount of leptin mRNA as abdominal fat tissue (Fig 3, lanes 5 to
7). Similar results were obtained when comparing leptin to
glyceraldehyde-3-phosphate dehydrogenase mRNA levels. Independent
experiments established that the multiplex RT/PCR assay was within the
linear range.
DISCUSSION
FOOTNOTES
Received for publication Nov 8, 1996; accepted Feb 5, 1997.
Reprint requests to (V.L.F.) Alfred I. duPont Institute, Department of Clinical Science, 1600 Rockland Rd, Wilmington, DE 19803.
ACKNOWLEDGMENTS
This study was supported by grants from the Nemours Foundation, Alfred I. duPont Institute (S.G.H., E. de L., D.V.S., M.L.S., S.S.K., D.M.O., A.R.S., V.L.F.), National Institutes of Health (R29DK51140) (R.V.C.), and American Diabetes Association (R.V.C.).
We would like to acknowledge Dr Jose Caro for his encouragement of this work and Dr Lee Zelley and Sylvia Smith, CRNP, for their helpful discussion regarding placental function.
ABBREVIATIONS
RT/PCR, reverse transcription/polymerase chain reaction. BMI, body mass index. SD, standard deviation. PCR, polymerase chain reaction. bp, base pairs.
REFERENCES
SPR 1996;39:309AThis article has been cited by other articles:
 |
|
 |
|
  D. M. Janicke and J. W. Finney Children's Primary Health Care Services: Social-Cognitive Factors Related to Utilization J. Pediatr. Psychol., December 1, 2003; 28(8): 547 - 558. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. A. Ehrhardt, A. W. Bell, and Y. R. Boisclair Spatial and developmental regulation of leptin in fetal sheep Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2002; 282(6): R1628 - R1635. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Dinkevich, J. Hupert, and V. A Moyer Evidence based paediatrics: Evidence based well child care BMJ, October 13, 2001; 323(7317): 846 - 849. [Full Text] [PDF]
|
|
|
|
 |
|
 A R B. Russell, A J B Emmerson, N Wilkinson, T Chant, D G Sweet, H L Halliday, B Holland, and E G Davies A trial of recombinant human granulocyte colony stimulating factor for the treatment of very low birthweight infants with presumed sepsis and neutropenia Arch. Dis. Child. Fetal Neonatal Ed., May 1, 2001; 84(3): 172F - 176. [Abstract] [Full Text]
|
|
|
|
 |
|
 F. P. Rivara Pediatric Injury Control in 1999: Where Do We Go From Here? Pediatrics, April 1, 1999; 103(4): 883 - 888. [Full Text]
|
|
|
|
 |
|
 J. Licinio, A. B. Negrao, C. Mantzoros, V. Kaklamani, M.-L. Wong, P. B. Bongiorno, A. Mulla, L. Cearnal, J. D. Veldhuis, J. S. Flier, et al. Synchronicity of frequently sampled, 24-h concentrations of circulating leptin, luteinizing hormone, and estradiol in healthy women PNAS, March 3, 1998; 95(5): 2541 - 2546. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
||
|
||
Home | My Pediatrics | Journal Information | Current Issue | Past Issues | Subscriptions & Services | Contact Us Click here for faster international access © 1997 American Academy of Pediatrics. All rights reserved. |
||
|
||
